Agrisera Magsi Murashige Himedia

Agrisera Antibodies culture medium beads elisa kits   451-AS01 011 Set of 10 plant anti-Lhca and anti-Lhcb 451-AS05 084 PsbA / D1 protein of PSII, C-terminal 451-AS06 142-16 PsbO / 16 kDa of the oxygen evolving 451-AS06 142-33 PsbO / 33 kDa of the oxygen evolving 451-AS06 146 PsbD / D2 protein of PSII 451-AS07 […]

Instant Blue 1L

Promotie
1 Liter  145 Euro

Instant Blue
protein

InstantBlue 1L (Instant Blue)

ISB1L Expedeon 1L bottle

EUR 192.00

Zelfde dag geleverd in Benelux

Eenstaps gelkleuring in 15 minuten of minder.

TM

Voordelen

Expedeon
Expedeon Instant Blue
  1. Ultrasnelle kleuring – levert resultaten op in 15 minuten of minder.

  2. Eenstaps procedure – wassen, fixeren, magnetron of ontkleuren is niet nodig. Haal de gel gewoon uit de cassette en doe deze in een bakje met InstantBlue.

  3. Hoge gevoeligheid – ongeveer 5-25 ng eiwit gedetecteerd per band.

  4. Superlage achtergrondkleuring – Verbetert de algehele resolutie en gevoeligheid van de gel en geen mogelijkheid van overkleuring betekent dat u uw gel voor onbepaalde tijd in de vlek kunt laten en nog steeds kunt lezen.

  5. Kwantitatief – Dezelfde gel-tot-gel-prestatie, ideaal voor het kwantificeren van proteïne door densitometrie.

  6. Niet giftig – ideaal voor regelmatig gebruik en verwijdering.

  7. Mass Specificatie compatibel *.

Commandez Instant Blue en France

BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

Onze aanbevolen producten

 

Elisa kits

USCN Life sciences biedt meer dan 5000 Elisa-kits voor analyse van verschillende cytobinls-groeifactoren in serum, plasma, weefselhomogentis, celcysaten, celkweek-supermaten en andere biologische vloeistoffen van mensen, ratten, muizen en andere
meer…

 

Signalway-antilichaam

Sab zet zich in voor het leveren van hoogwaardige antilichaamonderzoekstools voor de wereldwijde levenswetenschappelijke onderzoeken. Het ontwikkelt meer dan 4000 clunds van producten, die celsignaal Transductiekanker, Slemcel, immunolog, neurowetenschappen, apoktosis, infectieziekten en andere gebieden omvatten.
meer…

 

Benchtop Tools

BioCision, LLC, is een toonaangevende fabrikant van draagbare tafelgereedschappen. Hun zeer thermische geleidende buis- en plaatmodules en complementaire productlijnen zijn toepasbaar op een breed scala aan wetenschappelijke disciplines, waaronder cel- en weefselkweek en gyapusuata-virus en bacteriële, moleculaire biologie en vele andere.
meer…

 

Moleculaire biologie

Actgeny-fabrikanten Begrijpend assortiment van RCR, DNA, Rna Elitropl en protien Elektroforese die ultrasnelle, eenvoudige en toepasbare prestaties mogelijk maken.
meer…

 

Aangepast peptide

GL Biochem (Shanghai) Ltd. houdt zich bezig met onderzoek, ontwikkeling, productie en marketing van diverse biochemische en fijne chemicaliën, met name synthese op maat van peptiden, peptidereagentia en aanverwante producten.
meer…

 

Assaykits en antilichamen

We bieden een breed scala aan assaysets en antilichamen voor levenswetenschappelijk onderzoek en ontdekking.
meer…

 

Elisa Kits

Elabscience Biotechnology Co. Ltd (Elabscience) is een hightech biotechbedrijf, gespecialiseerd in reagentia van immunodiagnostische technologie. Het biedt meer dan 20.000 producten, waaronder ELISA-kits, antilichaam en eiwitten.
meer…

 

Proteomics

Expedeon Biedt echt innovatieve oplossingen waarmee wetenschappers sneller, beter en veiliger kunnen werken. Hun protien-ontdekkingslijn van monsterfractionering en protienfractioneringsproducten voor massaspectrometrie bevindt zich op het snijvlak van proteomische analyse.
meer…

 

Precisie biosystemen

Precision Biosystems biedt een instrumentele oplossing voor het moeilijke probleem van laboratoriumautomatisering. Hun BlotCycler ™ automatiseert het proces van western blotting en verbetert de werkstroom en vermindert de handarbeid door een unieke en creatieve benadering van eiwitanalyse te bieden. Alle stappen na eiwitoverdracht naar een membraan zijn volledig geautomatiseerd: schudden, blokkeren, hybridiseren, wassen en recyclen van het primaire antilichaam.
meer…

 

Instrumenten

Clinx Science Instruments is een toonaangevende fabrikant van BioImaging Systems in China. Hun rijk ervaren onderzoeksteam ontwikkelt en levert de meest professionele instrumenten en service aan de wetenschappelijke gemeenschap.
meer…

Meest voorkomende problemen van de Western-blot-assays.

 

De volgende gids dient als checklist voor de mogelijke oorzaken en oplossingen met betrekking tot enkele van de meest voorkomende problemen van de Western-blot-assays.

  1. Hoge achtergrond

    S.No. Mogelijke oorzaak Oplossing
    1 Te hoge antilichaamconcentratie
    • Optimaliseer en verlaag de antilichaamconcentratie
    2 Vorming van secundaire antilichaamvorming
    • Filtreer het secundaire antilichaam door een filter van 0,2 μm
    • Gebruik een nieuw secundair antilichaam
    3 Te hoge incubatietemperatuur van antilichamen
    • Incubeer het antilichaam bij 4 ° C
    4 Niet-specifieke secundaire antilichaambinding of kruisreactiviteit met blokkerende stof
    • Voer secundaire antilichaamcontrole uit (zonder de primaire)
    • Verlaag de concentratie van secundair antilichaam
    5 Kruisreactiviteit van primair of secundair antilichaam met blokkerende stof
    • Voeg Tween-20 toe aan de incubatie- en wasbuffer
    6 Incompatibele blokkerende stof
    • Vergelijk verschillende blokkeerbuffers
    7 Onvolledige blokkering
    • Optimaliseer de keuze van de blokkeerbuffer
    • Verhoog de eiwitconcentratie in het blokkerende middel
    • Blokkeringstijd en / of temperatuur optimaliseren; Blokkeer 2 uur bij normale temperatuur of ’s nachts bij 4 ° C
    • Voeg 0,05% Tween 20 wasmiddel toe aan het blokkeermiddel
    • Voeg 0,05% Tween 20 wasmiddel toe aan de oplossing van antilichaamverdunners
    8 Onvoldoende blokkering
    • Verleng de blokkeertijd of gebruik een compatibel blokkeermiddel (bijv. Magere melk, BSA, serum, enz.)
    9 Kruisreactiviteit van antilichaam met andere eiwitten
    • Gebruik een ander blokkeringsmiddel (Gebruik geen magere melk met biotinesysteem
    • Verlaag de concentratie van secundair antilichaam
    • Test kruisreactiviteit tussen secundair antilichaam en membraan
    10 Onvoldoende wassen
    • Verhoog het aantal wasbeurten en het buffervolume
    • Voeg 0,05% Tween 20 wasmiddel toe aan de wasbuffer
    11 Te lange belichtingstijd
    • Verkort de belichtingstijd
    12 Membraanprobleem
    • Gebruik een schoon pincet; Bedien met handschoenen
    • Gebruik nieuwe membranen
    • Zorg ervoor dat de vloeistof voldoende is om het membraan vochtig te houden
    • Gebruik de ontkleuringstabel tijdens incubatie
    • Vermijd overlappende membranen
    • Voorzichtig hanteren en beschadiging van het membraan vermijden
    13 Onvoldoende membraanwas
    • Verhoog het aantal wasbeurten
    14 Onverenigbaar membraan
    • De achtergrond van nitrocellulosemembraan is lager dan die van PVDF-membraan
    15 Droog membraan
    • Zorg ervoor dat het membraan bedekt is met voldoende vloeistof en voorkom dat het uitdroogt
    16 Verontreinigde buffer
    • Gebruik voor gebruik een nieuwe buffer of filterbuffer
    17 Verontreinigde apparatuur
    • Zorg ervoor dat alle apparatuur en gereedschappen schoon zijn en dat er geen gel op het membraan achterblijft
  2. Zwak / geen signaal

    S.No. Mogelijke oorzaak Oplossing
    1 Onjuiste eiwitoverdracht naar membraan
    • Vlekgel nadat de overdracht is voltooid om te bepalen of de overdracht efficiënt is
    • Gebruik Ponceau S om het membraan te kleuren om te bepalen of de overdracht efficiënt is
    • Zorg voor voldoende contact tussen gel en membraan tijdens overdracht
    • Zorg ervoor dat de transfersandwich correct is gemonteerd
    • Nat membraan volgens de instructie
    • Vermijd oververhitting tijdens elektro-overdracht
    • Gebruik positieve markeringen voor controle of molecuulgewicht
    • Overdrachtstijd en -stroom optimaliseren
    • Gebruik Boster’s membraanoverdrachtbuffer (AR1149)
    • Vermijd vernietiging van monsters (antigene determinant) bij hantering
    2 Onvoldoende eiwit- en membraanbinding
    • 20% methanol toevoegen aan de buffer
    • Gebruik een membraan met kleine boring
    3 Onvoldoende antilichaam
    • Verhoog de antilichaamconcentratie
    4 Onvoldoende antigeen
    • Laad meer eiwitten
    5 Antigeen maskeren door buffer te blokkeren
    • Vergelijk verschillende blokkeerbuffers
    • Optimaliseer de eiwitconcentratie van het blokkerende middel
    • Verkort de blokkeertijd
    6 Aanwezigheid van natriumazide in buffers
    • Verwijder natriumazide uit buffers
    7 Te korte belichtingstijd
    • Verleng de belichtingstijd van de film
    8 Te korte incubatietijd van het substraat
    • Verleng de incubatietijd van het substraat tot vijf minuten
    9 Vertering van eiwitten op membraan
    • Optimaliseer de hoeveelheid blokkerende agent
    10 Afbraak van eiwitten tijdens opslag
    • Bereid het eiwitmonster opnieuw voor
    11 Incompatibele primaire en secundaire antilichamen
    • Zorg ervoor dat primair antilichaam, secundair antilichaam, substraat, enzymsysteem en monsters compatibel zijn
    • Gebruik laadcontrole om de effectiviteit van het tweede detectiesysteem te testen
    12 Lage concentratie van primair antilichaam en / of secundair antilichaam
    • Verhoog de antilichaamconcentratie
    • Verhoog de incubatietijd
    13 Kruisreactiviteit tussen blokkerende stof en antilichamen (primair of secundair)
    • Gebruik een mild schoonmaakmiddel zoals Tween20
    • Veranderingsblokker (vaak gebruikt zijn melk, BSA, serum of gelatine)
    14 Onvermogen van primair antilichaam om het eiwit in het geteste monster te herkennen
    • Controleer instructie
    • Gebruik positieve controle
    15 Laag of geen gehalte aan doeleiwit (ineffectief antigeen)
    • Gebruik positieve controle
    • Verhoog de laadhoeveelheid tot 20-30 µg eiwit per putje
    • Gebruik proteaseremmer of fractionele extract-doeleiwit
    16 Onvoldoende overdracht en overmatig wassen
    • Controleer de overdracht met Ponceau S
    • Week PVDF-membraan in methanol
    • Vermijd overmatig wassen
    17 Overmatig blokkeren
    • Gebruik 0,05% magere melk of geen buffer met melkverdunners
    • Verander blokkerende agent
    • Verkort de blokkeertijd
    18 Verlies van de effectiviteit van primaire antilichamen
    • Maak verse antilichamen klaar en bewaar ze op de juiste manier wanneer ze niet worden gebruikt
    • Vermijd herhaaldelijk invriezen en ontdooien
    19 Remming van secundair antilichaam door natriumazide
    • Vermijd het gebruik van natriumazide samen met aan HRP geconjugeerde antilichamen
    20 Verlies van effectiviteit in enzymconjugaat en substraat
    • Meng enzymconjugaat en substraat (geen kleurontwikkeling wanneer enzym inactief is)
    • Gebruik geactiveerd enzymconjugaat en vers substraat
    21 Onjuiste natte overdracht voor membraan
    • Week het PVDF-membraan in 100% methanol
    22 Onvoldoende molecuulgewicht van doeleiwit (<10 kDa)
    • Gebruik een membraan met kleine boring
    • Overdrachttijd verkorten
    23 Gelijkheid of nabijheid in waarden tussen het iso-elektrische punt van het doeleiwit en de pH-waarde van de transferbuffer
    • Probeer andere buffers zoals CAPS-buffer (pH 10,5)
    • Probeer buffers met een lage pH-waarde, zoals azijnzuurbuffer
    24 Te hoge methanolconcentratie
    • Verlaag de methanolconcentratie of gebruik isopropylalcohol

 

MPDU1

Western Blot antibodies to the MPDU1 Gene

Rabbit Polyclonals

MPDU1 siRNA

20-abx924439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MPDU1 Antibody (HRP)

20-abx304518
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (FITC)

20-abx304519
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (Biotin)

20-abx304520
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 cloning plasmid

CSB-CL014744HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggcggccgaggcggacggaccgcttaaacggctgctcgtgccgattcttttacctgagaaatgctacgaccaacttttcgttcagtgggacttgcttcacgtcccctgcctcaagattctcctcagcaaaggcctggggctgggcattgtggctggctcacttctagtaaagct
  • Show more
Description: A cloning plasmid for the MPDU1 gene.

MPDU1 Polyclonal Antibody

A62970 100 µg
EUR 570.55
Description: The best epigenetics products

MPDU1 Antibody, HRP conjugated

1-CSB-PA014744LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPDU1 Antibody, FITC conjugated

1-CSB-PA014744LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPDU1 Antibody, Biotin conjugated

1-CSB-PA014744LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human MPDU1 ELISA KIT

ELI-14234h 96 Tests
EUR 824

Mouse Mpdu1 ELISA KIT

ELI-16579m 96 Tests
EUR 865

Human MPDU1 shRNA Plasmid

20-abx956331
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MPDU1 Recombinant Protein (Human)

RP019753 100 ug Ask for price

MPDU1 Recombinant Protein (Mouse)

RP151229 100 ug Ask for price

MPDU1 Recombinant Protein (Rat)

RP212120 100 ug Ask for price

MPDU1 Polyclonal Antibody, HRP Conjugated

A62971 100 µg
EUR 570.55
Description: kits suitable for this type of research

MPDU1 Polyclonal Antibody, FITC Conjugated

A62972 100 µg
EUR 570.55
Description: fast delivery possible

MPDU1 Polyclonal Antibody, Biotin Conjugated

A62973 100 µg
EUR 570.55
Description: reagents widely cited

Mpdu1 ORF Vector (Rat) (pORF)

ORF070708 1.0 ug DNA
EUR 506

MPDU1 ORF Vector (Human) (pORF)

ORF006585 1.0 ug DNA
EUR 95

Mpdu1 ORF Vector (Mouse) (pORF)

ORF050411 1.0 ug DNA
EUR 506

Mpdu1 sgRNA CRISPR Lentivector set (Rat)

K6170601 3 x 1.0 ug
EUR 339

MPDU1 sgRNA CRISPR Lentivector set (Human)

K1319501 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector set (Mouse)

K4472301 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6170602 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6170603 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6170604 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1319502 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1319503 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1319504 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4472302 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4472303 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4472304 1.0 ug DNA
EUR 154

MPDU1 Protein Vector (Mouse) (pPB-C-His)

PV201642 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPB-N-His)

PV201643 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-HA)

PV201644 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-His)

PV201645 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-C-His)

PV282830 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-N-His)

PV282831 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-HA)

PV282832 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-His)

PV282833 500 ng
EUR 603

MPDU1 Protein Vector (Human) (pPB-C-His)

PV026337 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPB-N-His)

PV026338 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-HA)

PV026339 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-His)

PV026340 500 ng
EUR 329

Mpdu1 3'UTR Luciferase Stable Cell Line

TU113346 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU163346 1.0 ml Ask for price

Mpdu1 3'UTR Luciferase Stable Cell Line

TU213328 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU263328 1.0 ml Ask for price

MPDU1 3'UTR GFP Stable Cell Line

TU064467 1.0 ml
EUR 1394

MPDU1 3'UTR Luciferase Stable Cell Line

TU014467 1.0 ml
EUR 1394

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

20-abx301940
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6170605 3 x 1.0 ug
EUR 376

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1319505 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4472305 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6170606 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6170607 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6170608 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1319506 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1319507 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1319508 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4472306 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4472307 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4472308 1.0 ug DNA
EUR 167

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-48T 48T
EUR 332
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-96T 96T
EUR 539
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-48T 48T
EUR 332
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-96T 96T
EUR 539
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

RPL18

RPL18 Antibody

34349-100ul 100ul
EUR 252

RPL18 Antibody

34349-50ul 50ul
EUR 187

RPL18 Antibody

1-CSB-PA003981
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL18. Recognizes RPL18 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPL18 Antibody

DF3700 200ul
EUR 304
Description: RPL18 Antibody detects endogenous levels of total RPL18.

RPL18 Antibody

CSB-PA229371-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL18. Recognizes RPL18 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL18 Antibody

CSB-PA229371-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL18. Recognizes RPL18 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL18 antibody

70R-5007 50 ug
EUR 467
Description: Rabbit polyclonal RPL18 antibody raised against the N terminal of RPL18

RPL18 antibody

70R-33945 100 ug
EUR 327
Description: Rabbit polyclonal RPL18 antibody

RPL18 siRNA

20-abx904651
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL18 siRNA

20-abx931927
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL18 siRNA

20-abx931928
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL18 Antibody

ABD3700 100 ug
EUR 438

anti-RPL18

YF-PA14437 100 ug
EUR 403
Description: Rabbit polyclonal to RPL18

anti-RPL18

YF-PA24605 50 ul
EUR 334
Description: Mouse polyclonal to RPL18

RPL18 Rabbit pAb

A10720-100ul 100 ul
EUR 308

RPL18 Rabbit pAb

A10720-200ul 200 ul
EUR 459

RPL18 Rabbit pAb

A10720-20ul 20 ul
EUR 183

RPL18 Rabbit pAb

A10720-50ul 50 ul
EUR 223

RPL18 Blocking Peptide

33R-6085 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL18 antibody, catalog no. 70R-5007

RPL18 Blocking Peptide

DF3700-BP 1mg
EUR 195

RPL18 Blocking Peptide

20-abx161420
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPL18 Conjugated Antibody

C34349 100ul
EUR 397

pCMV-SPORT6-RPL18

PVT12863 2 ug
EUR 391

Anti-RPL18 antibody

STJ113682 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18E family of ribosomal proteins that is a component of the 60S subunit. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-RPL18 (3D5)

YF-MA15241 100 ug
EUR 363
Description: Mouse monoclonal to RPL18

Canine RPL18 ELISA KIT

ELI-52515d 96 Tests
EUR 928

Mouse RPL18 shRNA Plasmid

20-abx972488
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL18 shRNA Plasmid

20-abx986700
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL18 shRNA Plasmid

20-abx954131
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL18 Recombinant Protein (Human)

RP026884 100 ug Ask for price

RPL18 Recombinant Protein (Human)

RP026887 100 ug Ask for price

RPL18 Recombinant Protein (Mouse)

RP168980 100 ug Ask for price

RPL18 Recombinant Protein (Rat)

RP226619 100 ug Ask for price

Ribosomal Protein L18 (RPL18) Antibody

20-abx121710
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L18 (RPL18) Antibody

20-abx014116
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ribosomal Protein L18 (RPL18) Antibody

abx029569-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein L18 (RPL18) Antibody

abx029569-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein L18 (RPL18) Antibody

abx331142-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein L18 (RPL18) Antibody

20-abx328891
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl18 ORF Vector (Rat) (pORF)

ORF075541 1.0 ug DNA
EUR 506

RPL18 ORF Vector (Human) (pORF)

ORF008962 1.0 ug DNA
EUR 95

RPL18 ORF Vector (Human) (pORF)

ORF008963 1.0 ug DNA
EUR 95

Rpl18 ORF Vector (Mouse) (pORF)

ORF056328 1.0 ug DNA
EUR 506

Human 60S ribosomal protein L18 (RPL18)

1-CSB-RP018644h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L18(RPL18),partial expressed in E.coli

Rpl18 sgRNA CRISPR Lentivector set (Rat)

K7019101 3 x 1.0 ug
EUR 339

Rpl18 sgRNA CRISPR Lentivector set (Mouse)

K4512701 3 x 1.0 ug
EUR 339

RPL18 sgRNA CRISPR Lentivector set (Human)

K1917301 3 x 1.0 ug
EUR 339

Rpl18 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7019102 1.0 ug DNA
EUR 154

Rpl18 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7019103 1.0 ug DNA
EUR 154

Rpl18 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7019104 1.0 ug DNA
EUR 154

Rpl18 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4512702 1.0 ug DNA
EUR 154

Rpl18 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4512703 1.0 ug DNA
EUR 154

Rpl18 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4512704 1.0 ug DNA
EUR 154

RPL18 sgRNA CRISPR Lentivector (Human) (Target 1)

K1917302 1.0 ug DNA
EUR 154

RPL18 sgRNA CRISPR Lentivector (Human) (Target 2)

K1917303 1.0 ug DNA
EUR 154

RPL18 sgRNA CRISPR Lentivector (Human) (Target 3)

K1917304 1.0 ug DNA
EUR 154

RPL18 Protein Vector (Rat) (pPB-C-His)

PV302162 500 ng
EUR 603

RPL18 Protein Vector (Rat) (pPB-N-His)

PV302163 500 ng
EUR 603

RPL18 Protein Vector (Rat) (pPM-C-HA)

PV302164 500 ng
EUR 603

RPL18 Protein Vector (Rat) (pPM-C-His)

PV302165 500 ng
EUR 603

RPL18 Protein Vector (Human) (pPB-C-His)

PV035845 500 ng
EUR 329

RPL18 Protein Vector (Human) (pPB-N-His)

PV035846 500 ng
EUR 329

RPL18 Protein Vector (Human) (pPM-C-HA)

PV035847 500 ng
EUR 329

RPL18 Protein Vector (Human) (pPM-C-His)

PV035848 500 ng
EUR 329

RPL18 Protein Vector (Human) (pPB-C-His)

PV035849 500 ng
EUR 329

RPL18 Protein Vector (Human) (pPB-N-His)

PV035850 500 ng
EUR 329

RPL18 Protein Vector (Human) (pPM-C-HA)

PV035851 500 ng
EUR 329

RPL18 Protein Vector (Human) (pPM-C-His)

PV035852 500 ng
EUR 329

RPL18 Protein Vector (Mouse) (pPB-C-His)

PV225310 500 ng
EUR 603

RPL18 Protein Vector (Mouse) (pPB-N-His)

PV225311 500 ng
EUR 603

RPL18 Protein Vector (Mouse) (pPM-C-HA)

PV225312 500 ng
EUR 603

RPL18 Protein Vector (Mouse) (pPM-C-His)

PV225313 500 ng
EUR 603

Rpl18 3'UTR Luciferase Stable Cell Line

TU118079 1.0 ml Ask for price

Rpl18 3'UTR GFP Stable Cell Line

TU168079 1.0 ml Ask for price

Rpl18 3'UTR Luciferase Stable Cell Line

TU219622 1.0 ml Ask for price

Rpl18 3'UTR GFP Stable Cell Line

TU269622 1.0 ml Ask for price

RPL18 3'UTR GFP Stable Cell Line

TU070854 1.0 ml
EUR 1394

RPL18 3'UTR Luciferase Stable Cell Line

TU020854 1.0 ml
EUR 1394

Rabbit 60S ribosomal protein L18(RPL18) ELISA kit

E04R0439-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L18(RPL18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L18(RPL18) ELISA kit

E04R0439-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L18(RPL18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L18(RPL18) ELISA kit

E04R0439-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L18(RPL18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L18(RPL18) ELISA kit

E02R0439-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L18(RPL18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L18(RPL18) ELISA kit

E02R0439-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L18(RPL18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L18(RPL18) ELISA kit

E02R0439-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L18(RPL18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L18(RPL18) ELISA kit

E03R0439-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L18(RPL18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RPL29

RPL29 Antibody

45731-100ul 100ul
EUR 252

RPL29 Antibody

45731-50ul 50ul
EUR 187

RPL29 Antibody

DF9130 200ul
EUR 304
Description: RPL29 Antibody detects endogenous levels of total RPL29.

RPL29 Antibody

20-abx218356
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL29 Antibody

20-abx124394
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RPL29 Antibody

abx034814-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RPL29 Antibody

abx034814-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RPL29 siRNA

20-abx904659
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL29 siRNA

20-abx931952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL29 siRNA

20-abx931953
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL29 Antibody

ABD9130 100 ug
EUR 438

RPL29 antibody

PAab09831 100 ug
EUR 386

anti-RPL29

YF-PA14438 50 ug
EUR 363
Description: Mouse polyclonal to RPL29

anti-RPL29

YF-PA14439 50 ug
EUR 363
Description: Mouse polyclonal to RPL29

anti-RPL29

YF-PA24608 50 ul
EUR 334
Description: Mouse polyclonal to RPL29

RPL29 Blocking Peptide

DF9130-BP 1mg
EUR 195

RPL29 Conjugated Antibody

C45731 100ul
EUR 397

RPL29 Rabbit pAb

A9138-100ul 100 ul
EUR 308

RPL29 Rabbit pAb

A9138-200ul 200 ul
EUR 459

RPL29 Rabbit pAb

A9138-20ul 20 ul Ask for price

RPL29 Rabbit pAb

A9138-50ul 50 ul Ask for price

anti- RPL29 antibody

FNab09831 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: RPL29
  • Uniprot ID: P47914
  • Gene ID: 6159
  • Research Area: Metabolism
Description: Antibody raised against RPL29

anti- RPL29 antibody

LSMab09831 100 ug
EUR 386

Anti-RPL29 antibody

STJ111584 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29E family of ribosomal proteins. The protein is also a peripheral membrane protein expressed on the cell surface that directly binds heparin. Although this gene was previously reported to map to 3q29-qter, it is believed that it is located at 3p21.3-p21.2. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Mouse RPL29 shRNA Plasmid

20-abx972495
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL29 shRNA Plasmid

20-abx985402
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL29 shRNA Plasmid

20-abx954144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL29 Recombinant Protein (Human)

RP091434 100 ug Ask for price

RPL29 Recombinant Protein (Mouse)

RP169022 100 ug Ask for price

RPL29 Recombinant Protein (Rat)

RP226658 100 ug Ask for price

Rpl29 ORF Vector (Rat) (pORF)

ORF075554 1.0 ug DNA
EUR 506

RPL29 ORF Vector (Human) (pORF)

ORF030479 1.0 ug DNA
EUR 405

Rpl29 ORF Vector (Mouse) (pORF)

ORF056342 1.0 ug DNA
EUR 506

Rpl29 sgRNA CRISPR Lentivector set (Rat)

K6926801 3 x 1.0 ug
EUR 339

Rpl29 sgRNA CRISPR Lentivector set (Mouse)

K4549901 3 x 1.0 ug
EUR 339

RPL29 sgRNA CRISPR Lentivector set (Human)

K1955101 3 x 1.0 ug
EUR 339

Rpl29 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6926802 1.0 ug DNA
EUR 154

Rpl29 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6926803 1.0 ug DNA
EUR 154

Rpl29 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6926804 1.0 ug DNA
EUR 154

Rpl29 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4549902 1.0 ug DNA
EUR 154

Rpl29 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4549903 1.0 ug DNA
EUR 154

Rpl29 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4549904 1.0 ug DNA
EUR 154

RPL29 sgRNA CRISPR Lentivector (Human) (Target 1)

K1955102 1.0 ug DNA
EUR 154

RPL29 sgRNA CRISPR Lentivector (Human) (Target 2)

K1955103 1.0 ug DNA
EUR 154

RPL29 sgRNA CRISPR Lentivector (Human) (Target 3)

K1955104 1.0 ug DNA
EUR 154

RPL29 Protein Vector (Human) (pPB-C-His)

PV121914 500 ng
EUR 552

RPL29 Protein Vector (Human) (pPB-N-His)

PV121915 500 ng
EUR 552

RPL29 Protein Vector (Human) (pPM-C-HA)

PV121916 500 ng
EUR 552

RPL29 Protein Vector (Human) (pPM-C-His)

PV121917 500 ng
EUR 552

RPL29 Protein Vector (Rat) (pPB-C-His)

PV302214 500 ng
EUR 603

RPL29 Protein Vector (Rat) (pPB-N-His)

PV302215 500 ng
EUR 603

RPL29 Protein Vector (Rat) (pPM-C-HA)

PV302216 500 ng
EUR 603

RPL29 Protein Vector (Rat) (pPM-C-His)

PV302217 500 ng
EUR 603

RPL29 Protein Vector (Mouse) (pPB-C-His)

PV225366 500 ng
EUR 603

RPL29 Protein Vector (Mouse) (pPB-N-His)

PV225367 500 ng
EUR 603

RPL29 Protein Vector (Mouse) (pPM-C-HA)

PV225368 500 ng
EUR 603

RPL29 Protein Vector (Mouse) (pPM-C-His)

PV225369 500 ng
EUR 603

Rpl29 3'UTR Luciferase Stable Cell Line

TU118092 1.0 ml Ask for price

Rpl29 3'UTR GFP Stable Cell Line

TU168092 1.0 ml Ask for price

Rpl29 3'UTR Luciferase Stable Cell Line

TU219635 1.0 ml Ask for price

Rpl29 3'UTR GFP Stable Cell Line

TU269635 1.0 ml Ask for price

RPL29 3'UTR GFP Stable Cell Line

TU071230 1.0 ml
EUR 1394

RPL29 3'UTR Luciferase Stable Cell Line

TU021230 1.0 ml
EUR 1394

Rabbit 60S ribosomal protein L29(RPL29) ELISA kit

E04R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L29(RPL29) ELISA kit

E04R0450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L29(RPL29) ELISA kit

E04R0450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L29(RPL29) ELISA kit

E02R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L29(RPL29) ELISA kit

E02R0450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L29(RPL29) ELISA kit

E02R0450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L29(RPL29) ELISA kit

E03R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L29(RPL29) ELISA kit

E03R0450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L29(RPL29) ELISA kit

E03R0450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L29(RPL29) ELISA kit

E01R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L29(RPL29) ELISA kit

E01R0450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L29(RPL29) ELISA kit

E01R0450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L29(RPL29) ELISA kit

E06R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L29(RPL29) ELISA kit

E06R0450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L29(RPL29) ELISA kit

E06R0450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L29(RPL29) ELISA kit

E08R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L29(RPL29) ELISA kit

E08R0450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L29(RPL29) ELISA kit

E08R0450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L29(RPL29) ELISA kit

E07R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L29(RPL29) ELISA kit

E07R0450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L29(RPL29) ELISA kit

E07R0450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey 60S ribosomal protein L29(RPL29) ELISA kit

E09R0450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey 60S ribosomal protein L29(RPL29) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RAD52

RAD52 siRNA

20-abx930782
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD52 siRNA

20-abx930783
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD52 antibody

70R-50303 100 ul
EUR 287
Description: Purified Polyclonal RAD52 antibody

RAD52 antibody

70R-35287 100 ug
EUR 327
Description: Purified Rabbit polyclonal RAD52 antibody

RAD52 Antibody

ABD7175 100 ug
EUR 438

RAD52 Antibody

37023-100ul 100ul
EUR 252

RAD52 antibody

38568-100ul 100ul
EUR 252

RAD52 Antibody

DF7175 200ul
EUR 304
Description: RAD52 Antibody detects endogenous levels of total RAD52.

RAD52 Antibody

1-CSB-PA955701
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAD52. Recognizes RAD52 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

RAD52 Antibody

1-CSB-PA003918
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAD52. Recognizes RAD52 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

RAD52 Antibody

1-CSB-PA279438
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAD52. Recognizes RAD52 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

20-abx002218
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

abx028842-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

abx028842-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

abx028907-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

abx028907-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

abx016190-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

20-abx326054
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

abx218153-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

DNA Repair Protein RAD52 Homolog (RAD52) Antibody

abx224217-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

abx224375-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

20-abx339943
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAD52 Homolog, DNA Repair Protein (RAD52) Antibody

20-abx210344
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAD52 Blocking Peptide

AF4731-BP 1mg
EUR 195

RAD52 Conjugated Antibody

C37023 100ul
EUR 397

Rad52 Polyclonal Antibody

ES3309-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Rad52 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Rad52 Polyclonal Antibody

ES3309-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Rad52 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Rad52 Polyclonal Antibody

ABP52310-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Rad52 around the non-phosphorylation site of Y104
  • Applications tips:
Description: A polyclonal antibody for detection of Rad52 from Human, Mouse. This Rad52 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rad52 around the non-phosphorylation site of Y104

Rad52 Polyclonal Antibody

ABP52310-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Rad52 around the non-phosphorylation site of Y104
  • Applications tips:
Description: A polyclonal antibody for detection of Rad52 from Human, Mouse. This Rad52 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rad52 around the non-phosphorylation site of Y104

Rad52 Polyclonal Antibody

ABP52310-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Rad52 around the non-phosphorylation site of Y104
  • Applications tips:
Description: A polyclonal antibody for detection of Rad52 from Human, Mouse. This Rad52 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rad52 around the non-phosphorylation site of Y104

RAD52 (pT104) Antibody

20-abx009772
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-RAD52 Antibody

A01580 100ug
EUR 432
Description: Rabbit Polyclonal RAD52 Antibody. Validated in WB and tested in Human.

Anti-Rad52 Antibody

A01580-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Rad52 Antibody (RAD52) detection.tested for WB in Human, Mouse.

RAD52 antibody (Tyr104)

70R-36454 100 ug
EUR 327
Description: Rabbit polyclonal RAD52 antibody (Tyr104)

RAD52 Rabbit pAb

A3077-100ul 100 ul
EUR 308

RAD52 Rabbit pAb

A3077-200ul 200 ul
EUR 459

RAD52 Rabbit pAb

A3077-20ul 20 ul
EUR 183

RAD52 Rabbit pAb

A3077-50ul 50 ul
EUR 223

Rad52 Protein (Human)

10-003 20ug
EUR 479
Description: The Rad52 Protein (Human) is available in Europe and for worldwide shipping via Gentaur.

Rad52 Protein (Human)

10-004 100ug
EUR 1184
Description: The Rad52 Protein (Human) is available in Europe and for worldwide shipping via Gentaur.

RAD52 Blocking Peptide

DF7175-BP 1mg
EUR 195

Anti-Rad52 antibody

STJ95334 200 µl
EUR 197
Description: Rabbit polyclonal to Rad52.

Anti-RAD52 antibody

STJ25282 100 µl
EUR 277
Description: The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51 related DNA recombination and repair. A pseudogene of this gene is present on chromosome 2. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known.

Human DNA repair protein RAD52 homolog, RAD52 ELISA KIT

ELI-14923h 96 Tests
EUR 824

Mouse DNA repair protein RAD52 homolog, Rad52 ELISA KIT

ELI-35550m 96 Tests
EUR 865

Chicken DNA repair protein RAD52 homolog, RAD52 ELISA KIT

ELI-30395c 96 Tests
EUR 928

Saccharomyces cerevisiae DNA repair and recombination protein RAD52 (RAD52)

1-CSB-EP361943SVG
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Saccharomyces cerevisiae DNA repair and recombination protein RAD52(RAD52),partial expressed in E.coli

RAD52 Homolog, DNA Repair Protein Phospho-Tyr104 (RAD52 pY104) Antibody

20-abx326306
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospho-RAD52 (Tyr104) Antibody

AF4431 200ul
EUR 376
Description: Phospho-RAD52 (Tyr104) Antibody detects endogenous levels of RAD52 only when phosphorylated at Tyr104.

RAD52 Cell ELISA Kit

abx595517-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Rad52 Motif 1 Antibody

20-abx115021
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAD52 (pY104) Blocking Peptide

20-abx063178
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human RAD52 shRNA Plasmid

20-abx953982
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAD52 shRNA Plasmid

20-abx972367
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-RAD52 (Y104) Antibody

1-CSB-PA040147
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RAD52 (Y104). Recognizes Phospho-RAD52 (Y104) from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Rad52 Recombinant Protein (Human)

RP086022 100 ug Ask for price

Rad52 Recombinant Protein (Rat)

RP223487 100 ug Ask for price

Rad52 Recombinant Protein (Mouse)

RP166511 100 ug Ask for price

Rad52 Recombinant Protein (Mouse)

RP166514 100 ug Ask for price

Rad52 Recombinant Protein (Mouse)

RP166517 100 ug Ask for price

Rad52 Recombinant Protein (Mouse)

RP166520 100 ug Ask for price

Phospho-RAD52 (Tyr104) Blocking Peptide

AF4431-BP 1mg
EUR 195

Rad52 (phospho Tyr104) Polyclonal Antibody

ES6976-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Rad52 (phospho Tyr104) from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Rad52 (phospho Tyr104) Polyclonal Antibody

ES6976-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Rad52 (phospho Tyr104) from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

RAD52 Homolog B (RAD52B) Antibody

20-abx121697
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rad52 (phospho Tyr104) Polyclonal Antibody

ABP55977-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Rad52 around the phosphorylation site of Y104
  • Applications tips:
Description: A polyclonal antibody for detection of Rad52 phospho Tyr104) from Human, Mouse, Monkey. This Rad52 phospho Tyr104) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rad52 around the phosphorylation site of Y104

Rad52 (phospho Tyr104) Polyclonal Antibody

ABP55977-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Rad52 around the phosphorylation site of Y104
  • Applications tips:
Description: A polyclonal antibody for detection of Rad52 phospho Tyr104) from Human, Mouse, Monkey. This Rad52 phospho Tyr104) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rad52 around the phosphorylation site of Y104

Rad52 (phospho Tyr104) Polyclonal Antibody

ABP55977-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Rad52 around the phosphorylation site of Y104
  • Applications tips:
Description: A polyclonal antibody for detection of Rad52 phospho Tyr104) from Human, Mouse, Monkey. This Rad52 phospho Tyr104) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Rad52 around the phosphorylation site of Y104

RAD52 ORF Vector (Human) (pORF)

ORF028675 1.0 ug DNA
EUR 405

Rad52 ORF Vector (Rat) (pORF)

ORF074497 1.0 ug DNA
EUR 506

Rad52 ORF Vector (Mouse) (pORF)

ORF055505 1.0 ug DNA
EUR 506

Rad52 ORF Vector (Mouse) (pORF)

ORF055506 1.0 ug DNA
EUR 506

Rad52 ORF Vector (Mouse) (pORF)

ORF055507 1.0 ug DNA
EUR 506

Rad52 ORF Vector (Mouse) (pORF)

ORF055508 1.0 ug DNA
EUR 506

Anti-Phospho-Rad52 (Y104) antibody

STJ90918 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-Rad52 (Y104).

RAD52 Colorimetric Cell-Based ELISA Kit

EKC1494 100ul
EUR 572

RAD52 Motif Containing 1 (RDM1) Antibody

20-abx123109
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAD52 Motif Containing 1 (RDM1) Antibody

20-abx014775
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

RAD52 Motif Containing 1 (RDM1) Antibody

20-abx323098
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAD52 Motif Containing 1 (RDM1) Antibody

20-abx320607
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAD52 Motif Containing 1 (RDM1) Antibody

20-abx321490
  • EUR 300.00
  • EUR 244.00