BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

MPDU1

Western Blot antibodies to the MPDU1 Gene

Rabbit Polyclonals

MPDU1 siRNA

20-abx924439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MPDU1 Antibody (HRP)

20-abx304518
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (FITC)

20-abx304519
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (Biotin)

20-abx304520
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 cloning plasmid

CSB-CL014744HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggcggccgaggcggacggaccgcttaaacggctgctcgtgccgattcttttacctgagaaatgctacgaccaacttttcgttcagtgggacttgcttcacgtcccctgcctcaagattctcctcagcaaaggcctggggctgggcattgtggctggctcacttctagtaaagct
  • Show more
Description: A cloning plasmid for the MPDU1 gene.

MPDU1 Polyclonal Antibody

A62970 100 µg
EUR 570.55
Description: The best epigenetics products

MPDU1 Antibody, HRP conjugated

1-CSB-PA014744LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPDU1 Antibody, FITC conjugated

1-CSB-PA014744LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPDU1 Antibody, Biotin conjugated

1-CSB-PA014744LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human MPDU1 ELISA KIT

ELI-14234h 96 Tests
EUR 824

Mouse Mpdu1 ELISA KIT

ELI-16579m 96 Tests
EUR 865

Human MPDU1 shRNA Plasmid

20-abx956331
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MPDU1 Recombinant Protein (Human)

RP019753 100 ug Ask for price

MPDU1 Recombinant Protein (Mouse)

RP151229 100 ug Ask for price

MPDU1 Recombinant Protein (Rat)

RP212120 100 ug Ask for price

MPDU1 Polyclonal Antibody, HRP Conjugated

A62971 100 µg
EUR 570.55
Description: kits suitable for this type of research

MPDU1 Polyclonal Antibody, FITC Conjugated

A62972 100 µg
EUR 570.55
Description: fast delivery possible

MPDU1 Polyclonal Antibody, Biotin Conjugated

A62973 100 µg
EUR 570.55
Description: reagents widely cited

Mpdu1 ORF Vector (Rat) (pORF)

ORF070708 1.0 ug DNA
EUR 506

MPDU1 ORF Vector (Human) (pORF)

ORF006585 1.0 ug DNA
EUR 95

Mpdu1 ORF Vector (Mouse) (pORF)

ORF050411 1.0 ug DNA
EUR 506

Mpdu1 sgRNA CRISPR Lentivector set (Rat)

K6170601 3 x 1.0 ug
EUR 339

MPDU1 sgRNA CRISPR Lentivector set (Human)

K1319501 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector set (Mouse)

K4472301 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6170602 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6170603 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6170604 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1319502 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1319503 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1319504 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4472302 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4472303 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4472304 1.0 ug DNA
EUR 154

MPDU1 Protein Vector (Mouse) (pPB-C-His)

PV201642 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPB-N-His)

PV201643 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-HA)

PV201644 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-His)

PV201645 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-C-His)

PV282830 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-N-His)

PV282831 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-HA)

PV282832 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-His)

PV282833 500 ng
EUR 603

MPDU1 Protein Vector (Human) (pPB-C-His)

PV026337 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPB-N-His)

PV026338 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-HA)

PV026339 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-His)

PV026340 500 ng
EUR 329

Mpdu1 3'UTR Luciferase Stable Cell Line

TU113346 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU163346 1.0 ml Ask for price

Mpdu1 3'UTR Luciferase Stable Cell Line

TU213328 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU263328 1.0 ml Ask for price

MPDU1 3'UTR GFP Stable Cell Line

TU064467 1.0 ml
EUR 1394

MPDU1 3'UTR Luciferase Stable Cell Line

TU014467 1.0 ml
EUR 1394

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

20-abx301940
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6170605 3 x 1.0 ug
EUR 376

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1319505 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4472305 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6170606 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6170607 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6170608 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1319506 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1319507 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1319508 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4472306 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4472307 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4472308 1.0 ug DNA
EUR 167

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-48T 48T
EUR 332
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-96T 96T
EUR 539
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-48T 48T
EUR 332
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-96T 96T
EUR 539
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sulfamethoxazole Msds

Sulfamethoxazole
B2040-50 50 mg
EUR 128
Description: Sulfamethoxazole
Sulfamethoxazole
B2040-S Evaluation Sample
EUR 81
Description: Sulfamethoxazole
Sulfamethoxazole
B1534-25G
EUR 207
Sulfamethoxazole
B1534-5G
EUR 109
Sulfamethoxazole
HY-B0322 10mM/1mL
EUR 141
Sulfamethoxazole
GA9313-100G 100 g
EUR 110
Sulfamethoxazole
GA9313-10G 10 g
EUR 50
Sulfamethoxazole
GA9313-25G 25 g
EUR 64
Sulfamethoxazole
GA9313-50G 50 g
EUR 80
Sulfamethoxazole
S045-100G 100 g
EUR 151
Sulfamethoxazole
S045-50G 50 g
EUR 92
Sulfamethoxazole-BSA
80-1504 1 mg
EUR 651
Description: BSA conjugated Sulfamethoxazole Hapten
Sulfamethoxazole-BSA
80-1505 1 mg
EUR 651
Description: BSA conjugated Sulfamethoxazole Hapten
Sulfamethoxazole-OVA
80-1506 1 mg
EUR 651
Description: OVA conjugated Sulfamethoxazole Hapten
Sulfamethoxazole-OVA
80-1507 1 mg
EUR 651
Description: OVA conjugated Sulfamethoxazole Hapten
Sulfamethoxazole sodium salt
GA2831-25G 25 g
EUR 94
Sulfamethoxazole sodium salt
GA2831-5G 5 g
EUR 58
Sulfamethoxazole ELISA Kit (OKAO00108)
OKAO00108 96 Wells
EUR 558
Description: Description of target: Sulfamethoxazole is a sulfonamide bacteriostatic antibiotic that is most commonly used in combination with trimethoprim as the drug Bactrim. Sulfamethoxazole competitively inhibits dihydropteroate synthase preventing the formation of dihydropteroic acid, a precursor of folic acid which is required for bacterial growth.;Species reactivity: General;Application: ;Assay info: Assay Methodology: Competitive Inhibition ELISA;Sensitivity:
ComponentAmount
Tissue(Method 1)0.1 ppb
Tissue(Method 2)1 ppb
Serum, Urine, Egg0.4 ppb
Honey0.1 ppb
Milk2 ppb
Feed4 ppb
Sulfamethoxazole (SMZ/SMX) ELISA Kit
abx364831-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Sulfamethoxazole related compound A EvoPure®
S063-25MG 25 mg
EUR 150
Sulfamethoxazole related compound A EvoPure®
S063-500MG 500 mg
EUR 383
Sulfamethoxazole related compound B EvoPure®
S064-100MG 100 mg
EUR 334

Strontium Sulfate Formula

Strontium Ranelate
HY-17397 500mg
EUR 684
Strontium Oxide
abx186564-500g 500 g
EUR 258
  • Shipped within 1-2 weeks.
Strontium Ranelate
A8526-10 10 mg
EUR 331
Description: Strontium Ranelate is a bone metabolism modulator that inhibits bone resorption while maintaining bone formation. Commonly used as an antiosteoporotic.
Strontium chloride hexahydrate
GK3876-1KG 1 kg
EUR 110
Strontium chloride hexahydrate
GK3876-500G 500 g
EUR 76
Strontium chloride hexahydrate
GK3876-5KG 5 kg
EUR 309
Strontium ranelate heptahydrate
20-abx184380
  • EUR 370.00
  • EUR 787.00
  • 1 g
  • 500 g
  • Shipped within 1-2 weeks.
ExpressMax™ Formula 1
137 500 g
EUR 102
ExpressMax™ Formula 2
138 500 g
EUR 102
ExpressMax™ Formula 3
139 500 g
EUR 102
ExpressMax™ Formula 4
140 500 g
EUR 102
ExpressMax™ Formula 5
141 500 g
EUR 102
ExpressMax™ Formula 6
142 500 g
EUR 102
ExpressMax™ Formula 7
143 500 g
EUR 102
ExpressMax™ Formula 8
144 500 g
EUR 102
Strontium nitrate, anhydrous, 98%
GK5693-1KG 1 kg
EUR 82
Strontium nitrate, anhydrous, 98%
GK5693-250G 250 g
EUR 50
Strontium nitrate, anhydrous, 98%
GK5693-5KG 5 kg
EUR 213
Strontium chloride hexahydrate, 99%, ACS grade
GX3549-500G 500 g
EUR 102
DerMend Moisturizing Bruise Formula Lotion , 8 Oz
LC3036-001 Ea
EUR 111
Cesium sulfate
CD0301 50g
EUR 87.41
  • Product category: Biochemicals/Misc. Biochemicals
MEG (sulfate)
C3992-10 10 mg
EUR 196
Description: MEG is a selective inhibitor of the inducible NO synthase (iNOS) [1]. NO synthase catalyses the oxidation of the amino acid L-arginine to citrulline and NO.
MEG (sulfate)
C3992-100 100 mg
EUR 1121
Description: MEG is a selective inhibitor of the inducible NO synthase (iNOS) [1]. NO synthase catalyses the oxidation of the amino acid L-arginine to citrulline and NO.
MEG (sulfate)
C3992-5 5 mg
EUR 126
Description: MEG is a selective inhibitor of the inducible NO synthase (iNOS) [1]. NO synthase catalyses the oxidation of the amino acid L-arginine to citrulline and NO.
MEG (sulfate)
C3992-50 50 mg
EUR 661
Description: MEG is a selective inhibitor of the inducible NO synthase (iNOS) [1]. NO synthase catalyses the oxidation of the amino acid L-arginine to citrulline and NO.
Nourseothricin (sulfate)
C5155-10 10 mg
EUR 171
Description: Nourseothricin is a broad-spectrum antibiotic. Nourseothricin is a broad-spectrum antibiotic derived from Streptomyces noursei.In vitro: Nourseothricin, represents a mixture of streptothricins, mainly D and F.
Nourseothricin (sulfate)
C5155-5 5 mg
EUR 119
Description: Nourseothricin is a broad-spectrum antibiotic. Nourseothricin is a broad-spectrum antibiotic derived from Streptomyces noursei.In vitro: Nourseothricin, represents a mixture of streptothricins, mainly D and F.
Nourseothricin (sulfate)
C5155-50 50 mg
EUR 572
Description: Nourseothricin is a broad-spectrum antibiotic. Nourseothricin is a broad-spectrum antibiotic derived from Streptomyces noursei.In vitro: Nourseothricin, represents a mixture of streptothricins, mainly D and F.
Apramycin Sulfate
B1665-50 50 mg
EUR 128
Description: Apramycin is an aminoglycoside antibiotic, which binds to the deep groove of the RNA.
Capreomycin Sulfate
B1689-5.1 10 mM (in 1mL H2O)
EUR 108
Description: Capreomycin Sulfate is a cyclic peptide antibiotic and thought to inhibit protein synthesis by binding to the 70S ribosomal unit.
Capreomycin Sulfate
B1689-50 50 mg
EUR 128
Description: Capreomycin Sulfate is a cyclic peptide antibiotic and thought to inhibit protein synthesis by binding to the 70S ribosomal unit.
Colistin Sulfate
B1716-50 50 mg
EUR 128
Description: Colistin is a cyclic cationic decapeptide linked to a fatty acid side chain, it belongs to a group of similarly structured bacterial antimicrobial peptides.
Neomycin sulfate
B1795-5.1 10 mM (in 1mL H2O)
EUR 108
Description: Neomycin sulfate
Neomycin sulfate
B1795-50 50 mg
EUR 128
Description: Neomycin sulfate
Netilmicin Sulfate
B1796-5 5 mg
EUR 187
Description: Netilmicin Sulfate is a member of the aminoglycoside family of antibiotics.
Paromomycin Sulfate
B1808-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: Paromomycin Sulfate is an aminoglycoside antibioticis inhibiting protein synthesis in non-resistant cells by binding to 16S ribosomal RNA.
Paromomycin Sulfate
B1808-50 50 mg
EUR 128
Description: Paromomycin Sulfate is an aminoglycoside antibioticis inhibiting protein synthesis in non-resistant cells by binding to 16S ribosomal RNA.
Ribostamycin Sulfate
B1825-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Ribostamycin is an aminoglycoside antibiotic, containing a neutral sugar moiety, and is produced by Streptomyces ribosidi?cus.
Ribostamycin Sulfate
B1825-50 50 mg
EUR 128
Description: Ribostamycin is an aminoglycoside antibiotic, containing a neutral sugar moiety, and is produced by Streptomyces ribosidi?cus.
Cefoselis Sulfate
B1906-50 50 mg
EUR 128
Description: Cefoselis is a widely used beta-lactam antibiotic.
Streptomycin sulfate
B2034-5.1 10 mM (in 1mL H2O)
EUR 108
Description: Streptomycin sulfate
Streptomycin sulfate
B2034-50 50 mg
EUR 128
Description: Streptomycin sulfate
Streptomycin sulfate
B2034-S Evaluation Sample
EUR 81
Description: Streptomycin sulfate
Vincristine sulfate
B2048-10
EUR 142
Vincristine sulfate
B2048-50
EUR 414
Hydroxychloroquine sulfate
B2051-250
EUR 240
Abacavir sulfate
B2220-10 10 mg
EUR 108
Description: Abacavir sulfate (ABC) is a powerful nucleoside analog reverse transcriptase inhibitor (NRTI) used to treat HIV and AIDS.
Abacavir sulfate
B2220-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Abacavir sulfate (ABC) is a powerful nucleoside analog reverse transcriptase inhibitor (NRTI) used to treat HIV and AIDS.
Abacavir sulfate
B2220-50 50 mg
EUR 160
Description: Abacavir sulfate (ABC) is a powerful nucleoside analog reverse transcriptase inhibitor (NRTI) used to treat HIV and AIDS.
Phenyl sulfate
B6050-25 25 mg
EUR 1210
Phenyl sulfate
B6050-5 5 mg
EUR 456
ZAPA sulfate
B6216-10 10 mg
EUR 258
ZAPA sulfate
B6216-50 50 mg
EUR 934
Arcaine sulfate
B6287-50 50 mg
EUR 242
Synthalin sulfate
B6386-10 10 mg
EUR 242
Synthalin sulfate
B6386-50 50 mg
EUR 870
Agmatine sulfate
B6470-1000 1 g
EUR 126
Agmatine sulfate
B6470-10000 10 g
EUR 586
Agmatine sulfate
B6470-5000 5 g
EUR 337
Gentamicin sulfate
B1270-1G
EUR 142
Gentamicin sulfate
B1270-25G
EUR 947
Gentamicin sulfate
B1270-5G
EUR 338
Acarbose sulfate
B1276-1000 1 g
EUR 138
Description: Acarbose sulfate, an anti-diabetic drug, is an inhibitor of alpha glucosidase.
Acarbose sulfate
B1276-2000 2 g
EUR 209
Description: Acarbose sulfate, an anti-diabetic drug, is an inhibitor of alpha glucosidase.
Acarbose sulfate
B1276-500 500 mg
EUR 105
Description: Acarbose sulfate, an anti-diabetic drug, is an inhibitor of alpha glucosidase.
Acarbose sulfate
B1276-5000 5 g
EUR 402
Description: Acarbose sulfate, an anti-diabetic drug, is an inhibitor of alpha glucosidase.
Terbutaline Sulfate
B1328-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Terbutaline Sulfate is a selective ?2-adrenergic receptor agonist with IC50 of 53 nM.
Terbutaline Sulfate
B1328-50 50 mg
EUR 128
Description: Terbutaline Sulfate is a selective ?2-adrenergic receptor agonist with IC50 of 53 nM.
Salbutamol Sulfate
B1348-250 250 mg
EUR 115
Description: Salbutamol is a short-acting, selective beta2-adrenergic receptor agonist used in the treatment of asthma and COPD. All the effects of R,S-salbutamol on guinea-pig skeletal muscles are due to the activity of the R-enantiomer. Thus there is a common enanti
Salbutamol Sulfate
B1348-5.1 10 mM (in 1mL H2O)
EUR 108
Description: Salbutamol is a short-acting, selective beta2-adrenergic receptor agonist used in the treatment of asthma and COPD. All the effects of R,S-salbutamol on guinea-pig skeletal muscles are due to the activity of the R-enantiomer. Thus there is a common enanti
Salbutamol Sulfate
B1348-500 500 mg
EUR 147
Description: Salbutamol is a short-acting, selective beta2-adrenergic receptor agonist used in the treatment of asthma and COPD. All the effects of R,S-salbutamol on guinea-pig skeletal muscles are due to the activity of the R-enantiomer. Thus there is a common enanti
Adenine sulfate
B1469-5.1 10 mM (in 1mL H2O)
EUR 108
Description: Adenine is a purine derivative and a nucleobase with a variety of roles in biochemistry. Adenine is a nucleobase with a variety of roles in biochemistry including cellular respiration, in the form of both the energy-rich adenosine triphosphate (ATP) and
Adenine sulfate
B1469-50 50 mg
EUR 128
Description: Adenine is a purine derivative and a nucleobase with a variety of roles in biochemistry. Adenine is a nucleobase with a variety of roles in biochemistry including cellular respiration, in the form of both the energy-rich adenosine triphosphate (ATP) and
Adenine sulfate
B1469-5000 5 g
EUR 100
Description: Adenine is a purine derivative and a nucleobase with a variety of roles in biochemistry. Adenine is a nucleobase with a variety of roles in biochemistry including cellular respiration, in the form of both the energy-rich adenosine triphosphate (ATP) and
Apramycin Sulfate
B1521-1G
EUR 113
Apramycin Sulfate
B1521-5G
EUR 294
Paromomycin Sulfate
B1528-1G
EUR 109
Paromomycin Sulfate
B1528-5G
EUR 251
Tobramycin Sulfate
B1538-100
EUR 109
Tobramycin Sulfate
B1538-500
EUR 251
Hydroxychloroquine Sulfate
B4874-5.1 10 mM (in 1mL H2O)
EUR 113
Hydroxychloroquine Sulfate
B4874-50 50 mg
EUR 108
Tobramycin Sulfate
B4958-50 50 mg
EUR 128
Capreomycin sulfate
C003-1G 1 g
EUR 212
Cefpirome Sulfate
C014-1G 1 g
EUR 203

Stronium Sulfide

Sulindac sulfide
B6074-5.1 10 mM (in 1mL DMSO)
EUR 154
Description: IC50: 1.9 and 1.21 µM for COX-1 and COX-2, respectivelySulindac sulfide is a non-steroidal COX inhibitor.
Diphenyl sulfide
abx184003-500g 500 g
EUR 370
  • Shipped within 1-2 weeks.
Sulindac Sulfide
20-abx076592
  • EUR 300.00
  • EUR 662.00
  • 10 mg
  • 50 mg
  • Shipped within 5-12 working days.
Ethyl propyl sulfide
abx181282-10g 10 g
EUR 272
  • Shipped within 1-2 weeks.
Ethyl phenyl sulfide
20-abx184689
  • EUR 258.00
  • EUR 203.00
  • 100 g
  • 25 g
  • Shipped within 1-2 weeks.
sec-Butyl Sulfide
20-abx185563
  • EUR 509.00
  • EUR 286.00
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Allyl methyl sulfide
HY-128447 100mg
EUR 108
Omeprazole metabolite Omeprazole sulfide
HY-G0006 100mg
EUR 533
Sulindac Sulfide (COX inhibitor)
SIH-261-10MG 10 mg
EUR 168
  • Sulindac is a nonsteroidal anti-inflammatory drug that is known to prevent recurrence and reduce colorectal polyps. It is a prodrug that is metabolized to a sulfide and sulfone derivative in vivo. The mechanism of action of both is the selective indu
  • Show more
Description: The substance Sulindac Sulfide is a cox inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is yellow solid which is soluble to 25 mM in DMSO, 3 mM in ethanol.
Sulindac Sulfide (COX inhibitor)
SIH-261-50MG 50 mg
EUR 433
  • Sulindac is a nonsteroidal anti-inflammatory drug that is known to prevent recurrence and reduce colorectal polyps. It is a prodrug that is metabolized to a sulfide and sulfone derivative in vivo. The mechanism of action of both is the selective indu
  • Show more
Description: The substance Sulindac Sulfide is a cox inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is yellow solid which is soluble to 25 mM in DMSO, 3 mM in ethanol.
Sulfide: Quinone Oxidoreductase, Mitochondrial (SQRDL) Antibody
20-abx123807
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sulfide: Quinone Oxidoreductase, Mitochondrial (SQRDL) Antibody
abx145131-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Sulfide: Quinone Oxidoreductase, Mitochondrial (SQRDL) Antibody
abx029112-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Sulfide: Quinone Oxidoreductase, Mitochondrial (SQRDL) Antibody
abx029112-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sulfide: Quinone Oxidoreductase, Mitochondrial (SQRDL) Antibody
abx238210-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sulfide: Quinone Oxidoreductase, Mitochondrial (SQRDL) Antibody
20-abx322018
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sulfide Quinone Reductase-Like (Yeast) (SQOR) Antibody
20-abx115887
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
2-Acetamidophenyl 5-chloro-2-nitrophenyl sulfide
C4686-10 10 mg
EUR 373
2-Acetamidophenyl 5-chloro-2-nitrophenyl sulfide
C4686-25 25 mg
EUR 757
2-Acetamidophenyl 5-chloro-2-nitrophenyl sulfide
C4686-5 5 mg
EUR 232
OxiSelect Free Hydrogen Sulfide Gas Assay Kit
XAN-5084 100 assays
EUR 427
Human Sulfide: quinone oxidoreductase, mitochondrial (SQRDL) ELISA Kit
abx383446-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Sulfide: quinone oxidoreductase, mitochondrial (SQRDL) ELISA Kit
abx390676-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
2-(E-2-decenoylamino)ethyl 2-(cyclohexylethyl) sulfide
HY-100287 10mg
EUR 2258

Stannous Chloride

Iron chloride (Ferric chloride), hexahydrate
FD0201 250g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals
MnTBAP Chloride
2058-10
EUR 120
MnTBAP Chloride
2058-50
EUR 251
Chelerythrine chloride
2064-5
EUR 180
Diphenyleneiodonium chloride
2358-5
EUR 131
Berberine Chloride
1830-100
EUR 115
Berberine Chloride
1830-500
EUR 272
Acetylcholine Chloride
B1596-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Acetylcholine in vertebrates is the major transmitter at neuromuscular junctions, autonomic ganglia, parasympathetic effector junctions, a subset of sympathetic effector junctions, and at many sites in the central nervous system. It is generally not used
Acetylcholine Chloride
B1596-50 50 mg
EUR 128
Description: Acetylcholine in vertebrates is the major transmitter at neuromuscular junctions, autonomic ganglia, parasympathetic effector junctions, a subset of sympathetic effector junctions, and at many sites in the central nervous system. It is generally not used
Acetylcholine Chloride
B1596-S Evaluation Sample
EUR 81
Description: Acetylcholine in vertebrates is the major transmitter at neuromuscular junctions, autonomic ganglia, parasympathetic effector junctions, a subset of sympathetic effector junctions, and at many sites in the central nervous system. It is generally not used
Bethanechol chloride
B1599-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Bethanechol Chloride is a selective muscarinic receptor agonist without any effect on nicotinic receptors.Bethanechol is a parasympathomimetic choline carbamate that selectively stimulates muscarinic receptors without any effect on nicotinic receptors. Un
Bethanechol chloride
B1599-50 50 mg
EUR 128
Description: Bethanechol Chloride is a selective muscarinic receptor agonist without any effect on nicotinic receptors.Bethanechol is a parasympathomimetic choline carbamate that selectively stimulates muscarinic receptors without any effect on nicotinic receptors. Un
Bethanechol chloride
B1599-S Evaluation Sample
EUR 81
Description: Bethanechol Chloride is a selective muscarinic receptor agonist without any effect on nicotinic receptors.Bethanechol is a parasympathomimetic choline carbamate that selectively stimulates muscarinic receptors without any effect on nicotinic receptors. Un
Trospium chloride
B1616-200 200 mg
EUR 431
Description: Trospium chloride is an antimuscarinic agent indicated for the treatment of overactive bladder with symptoms of urge urinary incontinence, urgency, and urinary frequency. Trospium has pharmacologic properties that are distinct from other antimuscarinic ag
Trospium chloride
B1616-25 25 mg
EUR 139
Description: Trospium chloride is an antimuscarinic agent indicated for the treatment of overactive bladder with symptoms of urge urinary incontinence, urgency, and urinary frequency. Trospium has pharmacologic properties that are distinct from other antimuscarinic ag
Trospium chloride
B1616-5.1 10 mM (in 1mL DMSO)
EUR 154
Description: Trospium chloride is an antimuscarinic agent indicated for the treatment of overactive bladder with symptoms of urge urinary incontinence, urgency, and urinary frequency. Trospium has pharmacologic properties that are distinct from other antimuscarinic ag
Trospium chloride
B1616-50 50 mg
EUR 187
Description: Trospium chloride is an antimuscarinic agent indicated for the treatment of overactive bladder with symptoms of urge urinary incontinence, urgency, and urinary frequency. Trospium has pharmacologic properties that are distinct from other antimuscarinic ag
Trospium chloride
B1616-S Evaluation Sample
EUR 81
Description: Trospium chloride is an antimuscarinic agent indicated for the treatment of overactive bladder with symptoms of urge urinary incontinence, urgency, and urinary frequency. Trospium has pharmacologic properties that are distinct from other antimuscarinic ag
Benzethonium Chloride
B1674-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Benzethonium chloride is a potent inhibitor of nAChRs, it inhibits ?4?2 nAChRs and ?7 nAChRs with IC50 of 49 nM and 122 nM, respectively.
Benzethonium Chloride
B1674-50 50 mg
EUR 128
Description: Benzethonium chloride is a potent inhibitor of nAChRs, it inhibits ?4?2 nAChRs and ?7 nAChRs with IC50 of 49 nM and 122 nM, respectively.
Cetylpyridinium Chloride
B1694-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Cetylpyridinium chloride is a cationic quaternary ammonium compound used as oropharyngeal antiseptic.
Cetylpyridinium Chloride
B1694-50 50 mg
EUR 128
Description: Cetylpyridinium chloride is a cationic quaternary ammonium compound used as oropharyngeal antiseptic.
Choline Chloride
B1703-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Choline chloride is a quaternary ammonium salt used as an additive for animal feed.
Choline Chloride
B1703-50 50 mg
EUR 128
Description: Choline chloride is a quaternary ammonium salt used as an additive for animal feed.
Dequalinium Chloride
B2191-250 250 mg
EUR 241
Description: Dequalinium Chloride (DECA) is a PKC inhibitor with IC50 of 7-18 ?M, and also a selective blocker of apamin-sensitive K+ channels with IC50 of 1.1 ?M [1][3].
Dequalinium Chloride
B2191-50 50 mg
EUR 113
Description: Dequalinium Chloride (DECA) is a PKC inhibitor with IC50 of 7-18 ?M, and also a selective blocker of apamin-sensitive K+ channels with IC50 of 1.1 ?M [1][3].
Delphinidin (chloride)
B2807-1
EUR 131
Delphinidin (chloride)
B2807-5
EUR 349
Oxybutynin chloride
B1134-100 100 mg
EUR 108
Description: Oxybutynin is an anticholinergic medication used to relieve urinary and bladder difficulties.
Oxybutynin chloride
B1134-5.1 10 mM (in 1mL DMSO)
EUR 200
Description: Oxybutynin is an anticholinergic medication used to relieve urinary and bladder difficulties.
MnTBAP Chloride
B5964-10 10 mg
EUR 125
Description: Superoxide (O(2)(·-)) is the proximal mitochondrial reactive oxygen species underlying pathology and redox signaling. This central role prioritizes development of a mitochondria-targeted reagent selective for controlling O(2)(·-).
MnTBAP Chloride
B5964-50 50 mg
EUR 264
Description: Superoxide (O(2)(·-)) is the proximal mitochondrial reactive oxygen species underlying pathology and redox signaling. This central role prioritizes development of a mitochondria-targeted reagent selective for controlling O(2)(·-).
Sanguinarine chloride
B5970-20 20 mg
EUR 224
Description: Sanguinarine chloride is a potent and specific inhibitor of PP2C with Ki value of 0.68 ?M, and is also a selective and cell-active inhibitor of MKP-1 with IC50 value of 10 ?M. Sanguinarine is also an allosteric activator of AMPK [1][2][3].
(±)-Acetylcarnitine chloride
B6273-100 100 mg
EUR 177
Description: (±)-Acetylcarnitine chloride is an agonist for cholinergic. Acetylcholine receptor (AChR) is an integral membrane protein receptor for acetylcholine.
(±)-Decanoylcarnitine chloride
B6315-50 50 mg
EUR 242
Description: (±)-Decanoylcarnitine chloride is an agonist for cholinergic and a homolog of acetylcarnitine chloride (Cat No. B6273). Acetylcholine receptor (AChR) is an integral membrane protein receptor for acetylcholine.
Diphenyleneiodonium chloride
B6326-10 10 mg
EUR 128
Description: Diphenyleneiodonium chloride (DPI) is an agonist of GPR3 with EC50 value of 1?M [1]. Also, diphenyleneiodonium chloride inhibits NADH oxidase (NOX), NO synthase and cytochrome P450 reductase [2] [3] [4].
(±)-Hexanoylcarnitine chloride
B6336-50 50 mg
EUR 242
Description: (±)-Hexanoylcarnitine chloride is an agonist for cholinergic and a homolog of acetylcarnitine chloride (Cat No. B6273). Acetylcholine receptor (AChR) is an integral membrane protein receptor for acetylcholine.
(±)-Lauroylcarnitine chloride
B6346-50 50 mg
EUR 242
(±)-Myristoylcarnitine chloride
B6354-50 50 mg
EUR 242
Description: (±)-Myristoylcarnitine chloride is an agonist for cholinergic and a homolog of acetylcarnitine chloride (Cat No. B6273). Acetylcholine receptor (AChR) is an integral membrane protein receptor for acetylcholine.
(±)-Octanoylcarnitine chloride
B6371-50 50 mg
EUR 242
(±)-Palmitoylcarnitine chloride
B6374-5.1 10 mM (in 1mL H2O)
EUR 108
(±)-Palmitoylcarnitine chloride
B6374-50 50 mg
EUR 197
(±)-Propionylcarnitine chloride
B6375-50 50 mg
EUR 242
Dansyl chloride
D705183 1g
EUR 87.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related
Sodium chloride
DB0483 500g
EUR 56.96
  • Product category: Biochemicals/Misc. Biochemicals
Cyanomethanesulfonyl Chloride
abx188664-10g 10 g
EUR 1358
  • Shipped within 1-2 weeks.
Dimethylthiocarbamoyl Chloride
abx188683-1000g 1000 g
EUR 481
  • Shipped within 1-2 weeks.
Phenylacetyl Chloride
abx188834-1kg 1 kg
EUR 328
  • Shipped within 1-2 weeks.
Polidronium Chloride
abx188843-1g 1 g
EUR 551
  • Shipped within 1-2 weeks.
Trichloroacetyl Chloride
abx188920-100g 100 g
EUR 244
  • Shipped within 1-2 weeks.
Tetrabutylammonium chloride
20-abx184782
  • EUR 230.00
  • EUR 189.00
  • EUR 356.00
  • 100 g
  • 25 g
  • 500 g
  • Shipped within 1-2 weeks.
Tetrapropylammonium chloride
20-abx184785
  • EUR 370.00
  • EUR 230.00
  • 100 g
  • 25 g
  • Shipped within 1-2 weeks.
Lanthanum chloride
20-abx184821
  • EUR 467.00
  • EUR 258.00
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Benzyl chloride
20-abx185355
  • EUR 495.00
  • EUR 189.00
  • EUR 272.00
  • EUR 203.00
  • 100 g
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Obidoxime Chloride
20-abx185527
  • EUR 384.00
  • EUR 2151.00
  • EUR 829.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Oxalyl chloride
abx185993-500g 500 g
EUR 272
  • Shipped within 1-2 weeks.
Ammonium chloride
20-abx186372
  • EUR 356.00
  • EUR 272.00
  • 1 kg
  • 500 g
  • Shipped within 1-2 weeks.
Cupric chloride
abx186417-5g 5 g
EUR 189
  • Shipped within 1-2 weeks.
Malonyl chloride
20-abx186494
  • EUR 356.00
  • EUR 230.00
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Propionyl chloride
abx186552-5g 5 g
EUR 203
  • Shipped within 1-2 weeks.
Sulfuryl chloride
20-abx186567
  • EUR 370.00
  • EUR 244.00
  • EUR 189.00
  • 10 kg
  • 2.5 kg
  • 500 g
  • Shipped within 1-2 weeks.
Decyltrimethylammonium chloride
abx183973-100g 100 g
EUR 314
  • Shipped within 1-2 weeks.
Dimethylcarbamoyl chloride
20-abx183999
  • EUR 217.00
  • EUR 203.00
  • EUR 370.00
  • 100 g
  • 25 g
  • 500 g
  • Shipped within 1-2 weeks.
Dodecylpyridinium chloride
abx184014-100g 100 g
EUR 272
  • Shipped within 1-2 weeks.
Ethanesulfonyl chloride
20-abx184031
  • EUR 203.00
  • EUR 189.00
  • EUR 356.00
  • 100 g
  • 25 g
  • 500 g
  • Shipped within 1-2 weeks.
Ethenesulfonyl chloride
20-abx184034
  • EUR 996.00
  • EUR 495.00
  • 1 g
  • 250 mg
  • Shipped within 1-2 weeks.
Methoxyacetyl chloride
abx184176-100g 100 g
EUR 314
  • Shipped within 1-2 weeks.
Lithium chloride
abx082015-100g 100 g
EUR 189
  • Shipped within 5-10 working days.
Cesium Chloride
20-abx082062
  • EUR 230.00
  • EUR 175.00
  • 100 g
  • 10 g
  • Shipped within 5-10 working days.
Sodium Chloride
abx082162-500g 500 g
EUR 189
  • Shipped within 5-10 working days.
Calcium chloride
abx082262-500g 500 g
EUR 203
  • Shipped within 5-10 working days.
Sodium Chloride
abx082422-500g 500 g
EUR 189
  • Shipped within 5-10 working days.
Chelerythrine Chloride
E1KS1292 5mg
EUR 247
Palmatine chloride
E1KS2397 200mg
EUR 247
Choline chloride
CB0299 100g
EUR 60.94
  • Product category: Culture Media/Supplements
Chlorocholine chloride
CB0736 5g
EUR 54.35
  • Product category: Culture Media/Growth Regulators/Plant
Cesium chloride
CDB0054 50g
EUR 70.88
  • Product category: Biochemicals/Misc. Biochemicals
Ammonium chloride
ADB0034 500g
EUR 58.7
  • Product category: Biochemicals/Biological Buffers/Buffer Related
Edrophonium (chloride)
C4140-1000 1 g
EUR 168
Description: Edrophonium is a competitive inhibitor of acetylcholinesterase (AChE) [1]. AChE is an extrinsic membrane-hound enzyme that functions in the central and peripheral nervous systems.
Edrophonium (chloride)
C4140-250 250 mg
EUR 102
Description: Edrophonium is a competitive inhibitor of acetylcholinesterase (AChE) [1]. AChE is an extrinsic membrane-hound enzyme that functions in the central and peripheral nervous systems.
Edrophonium (chloride)
C4140-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: Edrophonium is a competitive inhibitor of acetylcholinesterase (AChE) [1]. AChE is an extrinsic membrane-hound enzyme that functions in the central and peripheral nervous systems.
Edrophonium (chloride)
C4140-500 500 mg
EUR 138
Description: Edrophonium is a competitive inhibitor of acetylcholinesterase (AChE) [1]. AChE is an extrinsic membrane-hound enzyme that functions in the central and peripheral nervous systems.
Hemin chloride
C3984-10000 10 g
EUR 241
Description: Hemin chloride is an oxidized form of heme that inhibits eukaryotic translation initiation factor 2? kinase 1 (eIF2?K1), a repressor of eIF-2? [1]. The eukaryotic initiation factor 1 (eIF1) plays an important role in translation start site specificity.
Hemin chloride
C3984-25000 25 g
EUR 441
Description: Hemin chloride is an oxidized form of heme that inhibits eukaryotic translation initiation factor 2? kinase 1 (eIF2?K1), a repressor of eIF-2? [1]. The eukaryotic initiation factor 1 (eIF1) plays an important role in translation start site specificity.
Hemin chloride
C3984-5000 5 g
EUR 163
Description: Hemin chloride is an oxidized form of heme that inhibits eukaryotic translation initiation factor 2? kinase 1 (eIF2?K1), a repressor of eIF-2? [1]. The eukaryotic initiation factor 1 (eIF1) plays an important role in translation start site specificity.

Sulconazole Nitrate

Sulconazole Nitrate
B2036-50 50 mg
EUR 128
Description: Sulconazole Nitrate is an imidazole derivative with broad-spectrum antifungal activity.
Sulconazole Nitrate
B2036-S Evaluation Sample
EUR 81
Description: Sulconazole Nitrate is an imidazole derivative with broad-spectrum antifungal activity.
Sulconazole (nitrate)
HY-B1460A 100mg
EUR 133
Sertaconazole nitrate
B1831-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: Sertaconazole nitrate is a topical broad-spectrum antifungal that is developed to provide an additional agent for the treatment of superficial cutaneous and mucosal infections.
Sertaconazole nitrate
B1831-50 50 mg
EUR 128
Description: Sertaconazole nitrate is a topical broad-spectrum antifungal that is developed to provide an additional agent for the treatment of superficial cutaneous and mucosal infections.
Butoconazole nitrate
B1902-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Butoconazole nitrate
Butoconazole nitrate
B1902-50 50 mg
EUR 128
Description: Butoconazole nitrate
Butoconazole nitrate
B1902-S Evaluation Sample
EUR 81
Description: Butoconazole nitrate
Econazole nitrate
B1937-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Econazole nitrate
Econazole nitrate
B1937-50 50 mg
EUR 128
Description: Econazole nitrate
Econazole nitrate
B1937-S Evaluation Sample
EUR 81
Description: Econazole nitrate
Isoconazole nitrate
B1956-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Isoconazole nitrate
Isoconazole nitrate
B1956-50 50 mg
EUR 128
Description: Isoconazole nitrate
Isoconazole nitrate
B1956-S Evaluation Sample
EUR 81
Description: Isoconazole nitrate
Miconazole Nitrate
B1978-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Miconazole Nitrate
Miconazole Nitrate
B1978-50 50 mg
EUR 128
Description: Miconazole Nitrate
Miconazole Nitrate
B1978-S Evaluation Sample
EUR 81
Description: Miconazole Nitrate
Econazole nitrate
E001-100G 100 g
EUR 499
Econazole nitrate
E001-25G 25 g
EUR 208
Econazole nitrate
E001-5G 5 g
EUR 79
Thiamine nitrate
20-abx180904
  • EUR 314.00
  • EUR 759.00
  • 25 g
  • 500 g
  • Shipped within 1-2 weeks.
Isoconazole nitrate
20-abx184134
  • EUR 801.00
  • EUR 370.00
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Miconazole nitrate
20-abx184229
  • EUR 272.00
  • EUR 592.00
  • EUR 314.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Oxiconazole (nitrate)
C3418-1000 1 g
EUR 163
Description: Oxiconazole is a new imidazole derivative with a broad fungistatic spectrum against the agents of human mycoses in vitro. Subinhibitory concentrations of oxiconazole inhibited synthesis of DNA and decreased synthesis of RNA, protein and carbohydrate to a lesser extent.
Oxiconazole (nitrate)
C3418-25000 25 g
EUR 1185
Description: Oxiconazole is a new imidazole derivative with a broad fungistatic spectrum against the agents of human mycoses in vitro. Subinhibitory concentrations of oxiconazole inhibited synthesis of DNA and decreased synthesis of RNA, protein and carbohydrate to a lesser extent.
Oxiconazole (nitrate)
C3418-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: Oxiconazole is a new imidazole derivative with a broad fungistatic spectrum against the agents of human mycoses in vitro. Subinhibitory concentrations of oxiconazole inhibited synthesis of DNA and decreased synthesis of RNA, protein and carbohydrate to a lesser extent.
Oxiconazole (nitrate)
C3418-5000 5 g
EUR 390
Description: Oxiconazole is a new imidazole derivative with a broad fungistatic spectrum against the agents of human mycoses in vitro. Subinhibitory concentrations of oxiconazole inhibited synthesis of DNA and decreased synthesis of RNA, protein and carbohydrate to a lesser extent.
Barium nitrate
BB0119 1Kg
EUR 123.08
  • Product category: Biochemicals/Misc. Biochemicals
Fenticonazole Nitrate
A8432-10 10 mg
EUR 108
Description: Fenticonazole Nitrate is an azole antifungal drug that inhibits CYP51A1 (14 ?-demethylase) and ergosterol production. It shows active effects against Malassezia furfur and Candida albicans in vivo.
Fenticonazole Nitrate
A8432-5.1 10 mM (in 1mL DMSO)
EUR 122
Description: Fenticonazole Nitrate is an azole antifungal drug that inhibits CYP51A1 (14 ?-demethylase) and ergosterol production. It shows active effects against Malassezia furfur and Candida albicans in vivo.
Fenticonazole Nitrate
A8432-50 50 mg
EUR 270
Description: Fenticonazole Nitrate is an azole antifungal drug that inhibits CYP51A1 (14 ?-demethylase) and ergosterol production. It shows active effects against Malassezia furfur and Candida albicans in vivo.
Butoconazole (nitrate)
HY-B0293 10mM/1mL
EUR 126
Fenticonazole (Nitrate)
HY-B0359 10mM/1mL
EUR 134
Econazole (nitrate)
HY-B0453 5g
EUR 160
Miconazole (nitrate)
HY-B0454A 5g
EUR 160
Sertaconazole (nitrate)
HY-B0736A 10mM/1mL
EUR 113
Pilocarpine (nitrate)
HY-B1006 100mg
EUR 133
Oxiconazole nitrate
HY-B1324 10mg
EUR 133
Isoconazole (nitrate)
HY-B1444 100mg
EUR 158
Thiamine nitrate
HY-B2223 10mM/1mL
EUR 126
Dehydrocorydaline (nitrate)
HY-N4238 1mg
EUR 179
Thiamine nitrate
GV4958-100G 100 g
EUR 122
Thiamine nitrate
GV4958-25G 25 g
EUR 70
Fenticonazole nitrate
GP1083-100MG 100 mg
EUR 78
Fenticonazole nitrate
GP1083-250MG 250 mg
EUR 118
Isoconazole nitrate
GA9375-1G 1 g
EUR 62
Sodium nitrate
GK2648-100G 100 g
EUR 58
Silver nitrate
GK7224-100G 100 g
EUR 221
Silver nitrate
GK7224-10G 10 g
EUR 70
Silver nitrate
GK7224-250G 250 g
EUR 373
Silver nitrate
GK7224-25G 25 g
EUR 94
Silver nitrate
GK7224-50G 50 g
EUR 142
Silver nitrate
GK7224-5G 5 g
EUR 56
isa nitrate
ISA31 ea
EUR 91
nitrate electrode
ISE31B ea
EUR 352
Miconazole nitrate
M005-1G 1 g
EUR 62
Miconazole nitrate
M005-5G 5 g
EUR 173
NITRATE BROTH
N14-106-10kg 10 kg
EUR 1428
NITRATE BROTH
N14-106-2kg 2kg
EUR 350
NITRATE BROTH
N14-106-500g 500 g
EUR 131
NITRATE AGAR
N14-107-10kg 10 kg
EUR 1303
NITRATE AGAR
N14-107-2Kg 2 Kg
EUR 322
NITRATE AGAR
N14-107-500g 500 g
EUR 124
Potassium nitrate
PD0444 500g
EUR 63.92
  • Product category: Biochemicals/Misc. Biochemicals
Sodium nitrate
SD0484 500g
EUR 61.31
  • Product category: Biochemicals/Misc. Biochemicals
Silver nitrate
SB0479 25g
EUR 142.22
  • Product category: Biochemicals/Misc. Biochemicals
Dehydrocorydaline nitrate
TBW01112 20mg Ask for price
Econazole Nitrate (powder)
50R-R14827 50 mg
EUR 133
Description: Econazole Nitrate chemical reference substance
Aluminium nitrate nonahydrate
abx184820-100g 100 g
EUR 244
  • Shipped within 1-2 weeks.
Rhodium nitrate solution
20-abx186014
  • EUR 704.00
  • EUR 286.00
  • EUR 509.00
  • 10 g
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.
Calcium nitrate tetrahydrate
CB0258 500g
EUR 64.79
  • Product category: Biochemicals/Misc. Biochemicals
Nitrate Standard, 200UL
C086-200UL 200UL
EUR 123
Nitrate Reductase, 1EA
C088-1EA 1EA