BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

tra1 60

Bridge-It cAMP-PDE 60
PD1016-60 1 Kit
EUR 266
Magnetic Beads (DNA) 60 mL
P920-60 NULL
EUR 0
DiagNano Fluorophore Labeled Gold Nanoparticles, 60 nm
GFL-60 1 mL
EUR 1053
DiagNano Gold Nanoparticle Passive Conjugation Kit, 60 nm
GPK-60 1 kit
EUR 715
Anti-GPR94 / TRA1 antibody
STJ70946 100 µg
EUR 359
CORNING®60 X 15 MM PETRI DISH WITH COVER
70165-60 12/pk
EUR 119
Description: Vista Petri Dishes; PYREX VISTA Petri Dishes
DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 60 nm
GCK-M-60 1 kit
EUR 757
Polyclonal Goat Anti-GPR94 / TRA1 Antibody
AMM05001G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR94 / TRA1 . This antibody is tested and proven to work in the following applications:
ACA (Anticardiolipin Antibody IgM) ELISA test
60 96T/Box Ask for price
  • Area of application: Immunological infertility
Description: ELISA based test for quantitative detection of ACA (Anticardiolipin Antibody IgM)
HL-60
C0003023 One Frozen vial
EUR 485
Tween 60
GL6809-100ML 100 ml
EUR 44
Tween 60
GL6809-1L 1 l
EUR 86
Tween 60
GL6809-500ML 500 ml
EUR 62
hSP-60/ Rat hSP- 60 ELISA Kit
ELA-E0822r 96 Tests
EUR 886
Chicken Heat Shock Protein 60,HSP-60 ELISA
QY-E80062 96T
EUR 426
BAY 60-6583
B5612-10 10 mg
EUR 224
Description: BAY 60-6583 is a selective and potent agonist of adenosine A2B receptor with EC50 value of 3 nM [1]. The adenosine A2B receptor is a G-protein coupled adenosine receptor and is activated by high concentrations adenosine.
BAY 60-6583
B5612-25 25 mg
EUR 441
Description: BAY 60-6583 is a selective and potent agonist of adenosine A2B receptor with EC50 value of 3 nM [1]. The adenosine A2B receptor is a G-protein coupled adenosine receptor and is activated by high concentrations adenosine.
BAY 60-6583
B5612-5 5 mg
EUR 180
Description: BAY 60-6583 is a selective and potent agonist of adenosine A2B receptor with EC50 value of 3 nM [1]. The adenosine A2B receptor is a G-protein coupled adenosine receptor and is activated by high concentrations adenosine.
Bay 60-7550
HY-14992 100mg
EUR 3080
Bay 60-7550
GN2518-10MG 10 mg
EUR 907
Bay 60-7550
GN2518-50MG 50 mg
EUR 2582
ZeptoBind (60 mL)
0801184 60 mL
EUR 94.72
  • What is the product classification?
  • ZeptoBind is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.
AFP protein (>60%)
30-AA10 1 mg
EUR 314
Description: Purified native Human AFP protein
TRA-1-60
MO25035 100 ul
EUR 409
pQE- 60 Plasmid
PVT0531 2 ug
EUR 325
Human Heat Shock Protein 60(HSP-60)ELISA Kit
GA-E1791HM-48T 48T
EUR 289
Human Heat Shock Protein 60(HSP-60)ELISA Kit
GA-E1791HM-96T 96T
EUR 466
Rat heat shock protein 60(hSP-60)ELISA Kit
GA-E0529RT-48T 48T
EUR 317
Rat heat shock protein 60(hSP-60)ELISA Kit
GA-E0529RT-96T 96T
EUR 496
Mouse heat shock protein 60(hSP-60)ELISA Kit  
GA-E0642MS-48T 48T
EUR 336
Mouse heat shock protein 60(hSP-60)ELISA Kit  
GA-E0642MS-96T 96T
EUR 534
Rat HSP-60(Heat Shock Protein 60) ELISA Kit
ER1056 96T
EUR 476.25
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P63039
  • Alias: HSP-60/HSPD1(Heat Shock Protein 60)/cpn60/GROEL/SPG13/60 kDa chaperonin/Chaperonin 60/heat shock 60kD protein 1(chaperonin)/Heat shock protein 60/heat shock protein 65/HLD4/Hsp60/HSP65/HuCHA60
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml
Mouse HSP-60(Heat Shock Protein 60) ELISA Kit
EM1136 96T
EUR 476.25
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P63038
  • Alias: HSP-60/HSPD1(Heat Shock Protein 60)/cpn60/GROEL/SPG13/60 kDa chaperonin/Chaperonin 60/heat shock 60kD protein 1(chaperonin)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml
Mouse Heat Shock Protein 60 (HSP-60) CLIA Kit
abx197107-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Heat Shock Protein 60 (HSP-60) CLIA Kit
abx197108-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Heat Shock Protein 60,HSP-60 ELISA Kit
201-12-1775 96 tests
EUR 440
  • This Heat Shock Protein 60 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Heat Shock Protein 60, HSP-60 ELISA Kit
CSB-E08560h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Heat Shock Protein 60, HSP-60 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Heat Shock Protein 60, HSP-60 ELISA Kit
1-CSB-E08560h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Heat Shock Protein 60, HSP-60 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat heat shock protein 60, hSP-60 ELISA Kit
CSB-E08561r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat heat shock protein 60, hSP-60 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat heat shock protein 60, hSP-60 ELISA Kit
1-CSB-E08561r
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat heat shock protein 60, hSP-60 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse heat shock protein 60, hSP-60 ELISA Kit
CSB-E08562m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse heat shock protein 60, hSP-60 in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse heat shock protein 60, hSP-60 ELISA Kit
1-CSB-E08562m
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse heat shock protein 60, hSP-60 in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Chicken Heat Shock Protein 60, HSP-60 ELISA Kit
CSB-E06855Ch-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Heat Shock Protein 60, HSP-60 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Chicken Heat Shock Protein 60, HSP-60 ELISA Kit
1-CSB-E06855Ch
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Heat Shock Protein 60, HSP-60 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat heat shock protein 60,hSP-60 ELISA Kit
CN-01791R1 96T
EUR 452
Mouse heat shock protein 60,hSP-60 ELISA Kit
CN-02670M1 96T
EUR 470
Mouse heat shock protein 60,hSP-60 ELISA Kit
CN-02670M2 48T
EUR 320
Human Heat Shock Protein 60,HSP-60 ELISA Kit
CN-03814H1 96T
EUR 478
Human Heat Shock Protein 60,HSP-60 ELISA Kit
CN-03814H2 48T
EUR 329
Chicken Heat Shock Protein 60,HSP-60 ELISA Kit
CN-00816C1 96T
EUR 455
Chicken Heat Shock Protein 60,HSP-60 ELISA Kit
CN-00816C2 48T
EUR 304
Human Heat Shock Protein 60(HSP-60)ELISA Kit
QY-E01787 96T
EUR 361
Rat heat shock protein 60(hSP-60)ELISA Kit
QY-E11123 96T
EUR 400
Mouse heat shock protein 60(hSP-60)ELISA Kit
QY-E20715 96T
EUR 361
ELISA kit for Mouse HSP-60 (Heat Shock Protein 60)
E-EL-M0618 1 plate of 96 wells
EUR 377
  • Gentaur's HSP-60 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse HSP-60. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse HSP-60 (Heat Shock Protein 60) in samples from Serum, Plasma, Cell supernatant
CLIA kit for Mouse HSP-60 (Heat Shock Protein 60)
E-CL-M0374 1 plate of 96 wells
EUR 584
  • Gentaur's HSP-60 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse HSP-60 . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse HSP-60 (Heat Shock Protein 60) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat HSP-60 (Heat Shock Protein 60)
E-EL-R0478 1 plate of 96 wells
EUR 377
  • Gentaur's HSP-60 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat HSP-60. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat HSP-60 (Heat Shock Protein 60) in samples from Serum, Plasma, Cell supernatant
CLIA kit for Rat HSP-60 (Heat Shock Protein 60)
E-CL-R0325 1 plate of 96 wells
EUR 584
  • Gentaur's HSP-60 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat HSP-60 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat HSP-60 (Heat Shock Protein 60) in samples from Serum, Plasma, Cell supernatant
Rabbit Anti-Human SSA-60/Ro (60 kda) protein antiserum
SSA601-S 100 ul
EUR 457
Ro 60-0175 fumarate
B6878-10 10 mg
EUR 284
Ro 60-0175 fumarate
B6878-50 50 mg
EUR 1038
M-NFS-60 cells
C0003022 One Frozen vial
EUR 455
Florisil, 60 - 100 mesh
GE3010-100G 100 g
EUR 70
Florisil, 60 - 100 mesh
GE3010-250G 250 g
EUR 114
Chaperonin 60 (CPN60) Antibody
abx018160-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
Chaperonin 60 (CPN60) Antibody
abx018161-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.
IL2 (60-70) Peptide
20-abx266260
  • EUR 467.00
  • EUR 759.00
  • EUR 342.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.
Interleukin II (60-70)
A1030-1 1 mg
EUR 108
Description: Interleukin II (60-70), (C68H104N14O14S), is a peptide with the sequence NH2- LEU-THR-PHE-LYS-PHE-TYR-MET-PRO-LYS-LYS-ALA-COOH, MW= 1373.7.
Interleukin II (60-70)
A1030-10 10 mg
EUR 340
Description: Interleukin II (60-70), (C68H104N14O14S), is a peptide with the sequence NH2- LEU-THR-PHE-LYS-PHE-TYR-MET-PRO-LYS-LYS-ALA-COOH, MW= 1373.7.
Interleukin II (60-70)
A1030-25 25 mg
EUR 456
Description: Interleukin II (60-70), (C68H104N14O14S), is a peptide with the sequence NH2- LEU-THR-PHE-LYS-PHE-TYR-MET-PRO-LYS-LYS-ALA-COOH, MW= 1373.7.
Interleukin II (60-70)
A1030-5 5 mg
EUR 224
Description: Interleukin II (60-70), (C68H104N14O14S), is a peptide with the sequence NH2- LEU-THR-PHE-LYS-PHE-TYR-MET-PRO-LYS-LYS-ALA-COOH, MW= 1373.7.
Interleukin II (60-70)
5-01401 4 x 5mg Ask for price
R-60 filter, 50mm
2130452 2unit
EUR 301
Description: For AE-6935GL
Gold Colloid (60 nm)
62R-GC009 100 ml
EUR 467
Description: 60 nm Colloidal Gold particle suspension
Nde I unit: 60
YRNDE1 1 vial Ask for price

totalseq

Product not found

thy1 2

Product not found

thy1.2

Product not found

treg

T-Pro MycoClean spray
JT90-R002 500ml/BT
EUR 144
Human Normal Peripheral Blood CD4+/CD25+ Regulatory T Cells (T reg), Cryopreserved
PBCD4-25-C2M NULL
EUR 0
Human Normal Peripheral Blood CD4+/CD25+ Regulatory T Cells (T reg), Fresh
PBCD4-25-F2M NULL
EUR 0
T-Pro EZ Gel Solution 8%
JB02-B008M 500ml/BT
EUR 222
T-Pro EZ Gel Solution 8%
JB02-B008S 100ml/BT
EUR 135
T-Pro EZ Gel Solution 10%
JB02-B010M 500ml/BT
EUR 222
T-Pro EZ Gel Solution 10%
JB02-B010S 100ml/BT
EUR 135
T-Pro EZ Gel Solution 12%
JB02-B012M 500ml/BT
EUR 222
T-Pro EZ Gel Solution 12%
JB02-B012S 100ml/BT
EUR 135
T-Pro EZ Gel Solution 15%
JB02-B015M 500ml/BT
EUR 222
T-Pro EZ Gel Solution 15%
JB02-B015S 100ml/BT
EUR 135
T-Pro Separating or Resolving Buffer
JB03-C001 500ml/BT
EUR 152
T-Pro BCA Protein Assay kit
JB04-D001 500assay/KIT
EUR 204
T-Pro Transfer Blotting buffer (10X)
JB08-H001 500ml/BT
EUR 135
T-Pro Western Blot Stripping Reagent
JB11-K002 500ml/BT
EUR 178
T-Pro Aqua EZ Clean (M)
JT90-R001M 500ml/BT
EUR 332
T-Pro Aqua EZ Clean (S)
JT90-R001S 100ml/BT
EUR 151
T-Pro EZ stain Gel solution
JT90-R005M 500ml/BT
EUR 187
T-Pro EZ stain Gel solution
JT90-R005S 100ml/BT
EUR 126
T-Pro P-Fect Transfection Reagent
JT97-N005M 1.0ml/vial
EUR 222
T-Pro Plasmid Mini Kit (100)
RB94-YPD100 100preps/Kit
EUR 161
T-Pro Plasmid Mini Kit (250)
RB94-YPD250 250preps/Kit
EUR 222
T-Pro Plasmid Midi Kit (20)
RB94-YPI020 20preps/Kit
EUR 213
T-Pro Plasmid Maxi Kit (10)
RB94-YPM010 10preps/Kit
EUR 222
REG-4/ Rat REG- 4 ELISA Kit
ELA-E1819r 96 Tests
EUR 886
T-Pro BCA Protein Assay Reagent A
JB04-D001A 500ml/BT
EUR 170
T-Pro BCA Protein Assay Reagent B
JB04-D001B 12ml/BT
EUR 117
T-Pro Bradford Protein Assay kit(1X)
JB04-D002 500ml/BT
EUR 161
T-Pro Fast Blocking Buffer (in PBS)
JK92-W001 500ml/BT
EUR 187
T-Pro Fast Blocking Buffer (in TBS)
JK92-W002 500ml/BT
EUR 187
T-Pro Genomic DNA Midi Kit (20)
RB94-NGM020 20preps/kit
EUR 222
T-Pro Genomic DNA Mini Kit (100)
RB94-NGS100 100preps/kit
EUR 213
Optional CO2 gas regulator
H2300-REG 1 PC
EUR 2413.13
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
Testosterone (T) ELISA Kit
DLR-T-Ge-48T 48T
EUR 469
  • Should the Testosterone (T) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Testosterone (T) in samples from serum, plasma, urine or other biological fluids.
Testosterone (T) ELISA Kit
DLR-T-Ge-96T 96T
EUR 608
  • Should the Testosterone (T) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Testosterone (T) in samples from serum, plasma, urine or other biological fluids.
T-Pro Laemmli (SDS sample) Reagent (reducing 4X)
JB06-F002 10ml/BT
EUR 126
T-Pro Tris-Glycine-SDS running buffer (10X)
JB07-G001 500ml/BT
EUR 135
T-Pro Tris-Glycine-Native running buffer (10X)
JB07-G002 500ml/BT
EUR 135
T-Pro Semi Dry Transfer Blotting buffer (10X)
JB08-H002 500ml/BT
EUR 144
T-Pro Protein Free Blocking Buffer (in PBS)
JK92-W003 500ml/BT
EUR 187
T-Pro Protein Free Blocking Buffer (in TBS)
JK92-W004 500ml/BT
EUR 187
T-Pro Nonliposomal Transfection Reagent I (NTR I)
JT97-N001M 1.0ml/vial
EUR 187
T-Pro Nonliposomal Transfection Reagent II (NTR II)
JT97-N002M 1.0ml/vial
EUR 204
T-Pro Nonliposomal Transfection Reagent III (NTR III)
JT97-N006M 1.0ml/vial
EUR 222
T-Pro Endotoxin Removal Plasmid Midi kit (25)
RB94-EPI020 20preps/Kit
EUR 248
T-Pro Endotoxin Removal Plasmid Maxi kit (10)
RB94-EPM010 10preps/Kit
EUR 265
T-Pro Plant Genomic DNA Midi Kit (20)
RB94-PGM020 20preps/kit
EUR 222
T-Pro Plant Genomic DNA Mini Kit (100)
RB94-PGS100 100preps/kit
EUR 222
Calpain reg Antibody
20-abx141876
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
T-Pro Laemmli (SDS sample) Reagent (non-reducing 4X)
JB06-F003 10ml/BT
EUR 126
T-Pro LumiFast Plus Chemiluminescence Detection Kit (ECL Kit)
JT96-K002M 250ml*2/Kit
EUR 204
T-Pro LumiFast Plus Chemiluminescence Detection Kit (ECL Kit)
JT96-K002S 100ml*2/Kit
EUR 152
T-Pro LumiLong Plus Chemiluminescence Detection Kit (ECL Kit)
JT96-K004M 250ml*2/Kit
EUR 239
T-Pro LumiLong Plus Chemiluminescence Detection Kit (ECL Kit)
JT96-K004S 100ml*2/Kit
EUR 170
T-Pro Gel/PCR DNA Purification Maxi Kit (10)
RB94-NEL010 10preps/Kit
EUR 161
T-Pro Gel/PCR DNA Purification Mini Kit (100)
RB94-NES100 100preps/Kit
EUR 161
T-Pro Gel/PCR DNA Purification Mini Kit (250)
RB94-NES250 250preps/Kit
EUR 222
General Testosterone (T) ELISA Kit
RD-T-Ge-48Tests 48 Tests
EUR 467
General Testosterone (T) ELISA Kit
RD-T-Ge-96Tests 96 Tests
EUR 646
General Testosterone (T) ELISA Kit
RDR-T-Ge-48Tests 48 Tests
EUR 488
General Testosterone (T) ELISA Kit
RDR-T-Ge-96Tests 96 Tests
EUR 676
T-Pro Washing buffer in PBS and Tween-20 (10X)
JB09-I003 500ml/BT
EUR 144
T-Pro Washing buffer in TBS and Tween-20 (10X)
JB09-I004 500ml/BT
EUR 144
T-Pro Phosphate-Buffered Saline (PBS, 10X) for western blot washing
JB09-I001 500ml/BT
EUR 135
T-Pro Tris-Buffered Saline (TBS, 10X) for western blot washing
JB09-I002 500ml/BT
EUR 135
Cal-520® maleimide
20610 100 ug
EUR 393
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Fluo-8®, AM
21081 5x50 ug
EUR 132
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Fluo-8®, AM
21082 10x50 ug
EUR 202
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Fluo-8®, AM
21083 20x50 ug
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Cal-520®, AM
21130 10x50 ug
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Cal-520®, AM
21131 1 mg
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Cy3®-streptavidin conjugate
16912 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Cy5®-streptavidin conjugate
16913 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Cy7®-streptavidin conjugate
16914 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
CPN reg Polyclonal Antibody
ABP53796-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CPN reg
  • Applications tips:
Description: A polyclonal antibody for detection of CPN reg from Human. This CPN reg antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CPN reg

tregs

Product not found

tslpr

Recombinant Human TSLPR Protein, His, E.coli-10ug
QP13827-HIS-10ug 10ug
EUR 201
Recombinant Human TSLPR Protein, His, E.coli-20ug
QP13827-HIS-20ug 20ug
EUR 201
Recombinant Human TSLPR Protein, His, E.coli-2ug
QP13827-HIS-2ug 2ug
EUR 155
Recombinant Human TSLPR Protein, His, E.coli-5ug
QP13827-HIS-5ug 5ug
EUR 155
Recombinant Human TSLPR Protein, His, E.coli-1mg
QP13827-HIS-EC-1mg 1mg
EUR 2757
Recombinant Human TSLPR Protein, His, Insect-1mg
QP13827-HIS-INSECT-1mg 1mg
EUR 5251
TSLPR Thymic Stromal Lymphopoietin Receptor Human Recombinant Protein
PROTQ9HC73 Regular: 20ug
EUR 317
Description: TSLPR Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 232 amino acids (23-231 a.a.) and having a molecular mass of 26.6kDa.;TSLPR is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
TSLPR Human, Thymic Stromal Lymphopoietin Receptor Human Recombinant Protein, Sf9
PROTQ9HC73-1 Regular: 10ug
EUR 317
Description: TSLPR Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 218 amino acids (23-231) and having a molecular mass of 25.2kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;TSLPR is fused to a 6 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

tlr

TLR-9/ Rat TLR- 9 ELISA Kit
ELA-E0709r 96 Tests
EUR 886
TLR-9, DNA aptamer, Biotinylated
AD-158-B Custom Ask for price
TLR-9, DNA aptamer, unlabeled
AD-158-U Custom Ask for price
Human TLR-9 ELISA Kit
EHT0528 96Tests
EUR 521
Goat TLR-9 ELISA Kit
EGTT0528 96Tests
EUR 521
Bovine TLR-9 ELISA Kit
EBT0528 96Tests
EUR 521
Chicken TLR-9 ELISA Kit
ECKT0528 96Tests
EUR 521
Anserini TLR-9 ELISA Kit
EAT0528 96Tests
EUR 521
Canine TLR-9 ELISA Kit
ECT0528 96Tests
EUR 521
Porcine TLR-9 ELISA Kit
EPT0528 96Tests
EUR 521
Rat TLR-9 ELISA Kit
ERT0528 96Tests
EUR 521
Sheep TLR-9 ELISA Kit
EST0528 96Tests
EUR 521
Rabbit TLR-9 ELISA Kit
ERTT0528 96Tests
EUR 521
Monkey TLR-9 ELISA Kit
EMKT0528 96Tests
EUR 521
Mouse TLR-9 ELISA Kit
EMT0528 96Tests
EUR 521
Recombinant Human TLR-3 Protein
PROTO15455 25ug
EUR 317
Description: TLR-3 is a single-pass type I receptor that binds to and signals the presence of microbial pathogens and double stranded RNA (dsRNA) viruses. Signaling through TLR-3 can promote the NF-κB pathway to initiate innate and adaptive immune responses to bacterial and viral infections, as well as the p53 pathway to trigger apoptosis in cells infected with dsRNA viruses. TLR-3 belongs to a family of structurally-related toll-like receptors (TLRs) containing an N-terminal domain rich in leucine repeats and a C-terminal intracellular Toll/interleukin (IL)-1 (TIL) domain. TLR-3 is expressed primarily in dendritic cells of the placenta and pancreas where it can reside on both sides of the plasma membrane and in the endosomal compartment of the cells. Recombinant human TLR-3 is 77.4 kDa glycoprotein containing 681 residues which comprise the TLR-3 extracellular domain.
TLR-9, DNA aptamer, FITC labelled
AD-158-F Custom Ask for price
Guinea Pig TLR-9 ELISA Kit
EGT0528 96Tests
EUR 521
Human CellExp? TLR-3, Human Recombinant
7220-10
EUR 207
Human CellExp? TLR-3, Human Recombinant
7220-50
EUR 675
Monoclonal TLR-1 Antibody (extracellular), Clone: EPR2075
APR10451G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TLR-1 (extracellular). The antibodies are raised in Rabbit and are from clone EPR2075. This antibody is applicable in WB
Monoclonal TLR-2 Antibody (extracellular), Clone: EPR2078Y
APG02992G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TLR-2 (extracellular). The antibodies are raised in Rabbit and are from clone EPR2078Y. This antibody is applicable in WB
Mouse Toll-like receptor 9(TLR-9)ELISA Kit  
GA-E0185MS-48T 48T
EUR 336
Mouse Toll-like receptor 9(TLR-9)ELISA Kit  
GA-E0185MS-96T 96T
EUR 534
Rat Toll-like receptor 9(TLR-9)ELISA Kit
GA-E0091RT-48T 48T
EUR 354
Rat Toll-like receptor 9(TLR-9)ELISA Kit
GA-E0091RT-96T 96T
EUR 571
Rat Toll-Like Receptor 2 (TLR-2) CLIA Kit
abx195372-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Toll-like Receptor 9 (TLR-9) CLIA Kit
abx197813-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Toll-like receptor 9,TLR-9 ELISA kit
201-12-0357 96 tests
EUR 440
  • This Toll-like receptor 9 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Toll-like receptor 9, TLR-9 ELISA kit
CSB-E09821h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Toll-like receptor 9, TLR-9 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Toll-like receptor 9, TLR-9 ELISA kit
1-CSB-E09821h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Toll-like receptor 9, TLR-9 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Toll-like receptor 9, TLR-9 ELISA kit
CSB-E09864r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Toll-like receptor 9, TLR-9 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat Toll-like receptor 9, TLR-9 ELISA kit
1-CSB-E09864r
  • EUR 967.00
  • EUR 5925.00
  • EUR 3134.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Toll-like receptor 9, TLR-9 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Toll-like receptor 5, TLR-5 ELISA kit
CSB-E12744m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Toll-like receptor 5, TLR-5 in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Toll-like receptor 5, TLR-5 ELISA kit
1-CSB-E12744m
  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Toll-like receptor 5, TLR-5 in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Toll-like receptor 7, TLR-7 ELISA Kit
CSB-E14341m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Toll-like receptor 7, TLR-7 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Toll-like receptor 7, TLR-7 ELISA Kit
1-CSB-E14341m
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Toll-like receptor 7, TLR-7 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human toll-like receptor 7, TLR-7 ELISA Kit
CSB-E14909h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human toll-like receptor 7, TLR-7 in samples from serum, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human toll-like receptor 7, TLR-7 ELISA Kit
1-CSB-E14909h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human toll-like receptor 7, TLR-7 in samples from serum, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Toll-like receptor 9,TLR-9 ELISA kit
CN-01651R1 96T
EUR 458
Rat Toll-like receptor 9,TLR-9 ELISA kit
CN-01651R2 48T
EUR 307
Mouse Toll-like receptor 9,TLR-9 ELISA kit
CN-02526M1 96T
EUR 457
Mouse Toll-like receptor 9,TLR-9 ELISA kit
CN-02526M2 48T
EUR 306
Human Toll-like receptor 9,TLR-9 ELISA kit
CN-04125H1 96T
EUR 481
Human Toll-like receptor 9,TLR-9 ELISA kit
CN-04125H2 48T
EUR 332
Rat Toll-like receptor 9(TLR-9)ELISA Kit
QY-E11562 96T
EUR 361
Mouse Toll-like receptor 9(TLR-9)ELISA Kit
QY-E21483 96T
EUR 374
Human Toll-like receptor 9(TLR-9/CD289)ELISA Kit
GA-E0373HM-48T 48T
EUR 289
Human Toll-like receptor 9(TLR-9/CD289)ELISA Kit
GA-E0373HM-96T 96T
EUR 466
Human Soluble Toll-like Receptor 6(TLR-6) ELISA Kit
CSB-E15888h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Soluble Toll-like Receptor 6 (TLR-6) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Soluble Toll-like Receptor 6(TLR-6) ELISA Kit
1-CSB-E15888h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Soluble Toll-like Receptor 6(TLR-6) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
ELISA kit for Rat TLR-2 (Toll-like Receptor 2)
E-EL-R0907 1 plate of 96 wells
EUR 534
  • Gentaur's TLR-2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TLR-2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat TLR-2 (Toll-like Receptor 2) in samples from Serum, Plasma, Cell supernatant
CLIA kit for Rat TLR-2 (Toll-Like Receptor 2)
E-CL-R0614 1 plate of 96 wells
EUR 584
  • Gentaur's TLR-2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat TLR-2 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat TLR-2 (Toll-Like Receptor 2) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human TLR-2 (Toll-like Receptor 2)
E-EL-H0951 1 plate of 96 wells
EUR 534
  • Gentaur's TLR-2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TLR-2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TLR-2 (Toll-like Receptor 2) in samples from Serum, Plasma, Cell supernatant
ODN TTAGGG-Class G Human-TLR 9 Antagonist, antigen grade
ODNTT-1 1 mg
EUR 651
ODN TTAGGG-Class G Human-TLR 9 Antagonist, antigen grade
ODNTT-1NC 1 mg
EUR 651
ELISA kit for Rat Toll-like receptor 7 (TLR-7)
KTE100110-48T 48T
EUR 332
  • Toll-like receptor 7is a member of the Toll-like receptor family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Toll-like receptor 7 (TLR-7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Toll-like receptor 7 (TLR-7)
KTE100110-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Toll-like receptor 7is a member of the Toll-like receptor family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Toll-like receptor 7 (TLR-7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rat Toll-like receptor 7 (TLR-7)
KTE100110-96T 96T
EUR 539
  • Toll-like receptor 7is a member of the Toll-like receptor family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Toll-like receptor 7 (TLR-7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Toll-like receptor 5 (TLR-5)
KTE70209-48T 48T
EUR 354
  • Toll-like receptor 5is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional s
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Toll-like receptor 5 (TLR-5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Toll-like receptor 5 (TLR-5)
KTE70209-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Toll-like receptor 5is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional s
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Toll-like receptor 5 (TLR-5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Toll-like receptor 5 (TLR-5)
KTE70209-96T 96T
EUR 572
  • Toll-like receptor 5is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional s
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Toll-like receptor 5 (TLR-5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Toll-like receptor 7 (TLR-7)
KTE62321-48T 48T
EUR 332
  • Toll-like receptor 7is a member of the Toll-like receptor family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Toll-like receptor 7 (TLR-7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Toll-like receptor 7 (TLR-7)
KTE62321-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Toll-like receptor 7is a member of the Toll-like receptor family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Toll-like receptor 7 (TLR-7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Toll-like receptor 7 (TLR-7)
KTE62321-96T 96T
EUR 539
  • Toll-like receptor 7is a member of the Toll-like receptor family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Toll-like receptor 7 (TLR-7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Toll-like receptor 5 (TLR-5)
KTE60313-48T 48T
EUR 354
  • Toll-like receptor 5is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Toll-like receptor 5 (TLR-5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Toll-like receptor 5 (TLR-5)
KTE60313-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Toll-like receptor 5is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Toll-like receptor 5 (TLR-5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Toll-like receptor 5 (TLR-5)
KTE60313-96T 96T
EUR 572
  • Toll-like receptor 5is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional s
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Toll-like receptor 5 (TLR-5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Toll-like receptor 9(TLR-9/CD289)ELISA Kit
QY-E04527 96T
EUR 394
ELISA kit for Mouse TLR-2/CD282 (Toll-like Receptor 2)
E-EL-M2418 1 plate of 96 wells
EUR 534
  • Gentaur's TLR-2/CD282 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TLR-2. Standards or samples are added to the micro ELISA plate wells and combined
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse TLR-2/CD282 (Toll-like Receptor 2) in samples from Serum, Plasma, Cell supernatant
ODN 2336- Type A human specific TLR 9 agonist-antigen grade
ODN2336-1 1 mg
EUR 651
ODN 2336- Type A human specific TLR 9 agonist-antigen grade
ODN2336-5 5 mg
EUR 1991
ODN 2336 -Type A human specific TLR 9 agonist-antigen grade
ODN2336-F Custom Ask for price
ELISA kit for Human Soluble Toll-like Receptor 6 (TLR-6)
KTE62322-48T 48T
EUR 332
  • Toll Like Receptor 6 is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Soluble Toll-like Receptor 6 (TLR-6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Soluble Toll-like Receptor 6 (TLR-6)
KTE62322-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Toll Like Receptor 6 is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Soluble Toll-like Receptor 6 (TLR-6) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

tox

TOX antibody
70R-8006 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TOX antibody
TOX Antibody
1-CSB-PA024073LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500
TOX siRNA
20-abx937787
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TOX siRNA
20-abx937788
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TOX Polyclonal Antibody
30803-100ul 100ul
EUR 252
TOX Polyclonal Antibody
30803-50ul 50ul
EUR 187
Anti-TOX Antibody
A08441 100 ug
EUR 397
Description: Rabbit Polyclonal TOX Antibody. Validated in IHC, WB and tested in Human.
TOX Blocking Peptide
33R-1732 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TOX antibody, catalog no. 70R-8006
ToX Antigen (ROP)
E61Y00303 1mg
EUR 700
ToX Antigen (MIC3)
E61Y00304 1mg
EUR 700
ToX Antigen (GRA6)
E61Y00306 1mg
EUR 700
TOX cloning plasmid
CSB-CL024073HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1581
  • Sequence: atggacgtaagattttatccacctgtagcccagcccgccgctgcgcccgacgctccctgtctgggaccttctccctgcctggacccctactattgcaacaagtttgacggtgagaacatgtatatgagcatgacagagccgagccaggactatgtgccagccagccagtcctacc
  • Show more
Description: A cloning plasmid for the TOX gene.
TOX Polyclonal Antibody
A68731 100 ?g
EUR 628.55
Description: reagents widely cited
TOX Rabbit pAb
A7050-100ul 100 ul
EUR 308
TOX Rabbit pAb
A7050-200ul 200 ul
EUR 459
TOX Rabbit pAb
A7050-20ul 20 ul
EUR 183
TOX Rabbit pAb
A7050-50ul 50 ul
EUR 223
Anti-TOX antibody
STJ29130 100 µl
EUR 277
Description: The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.
ToX Antigen (P30,SAG1)
E61Y00301 1mg
EUR 700
ToX Antigen (P29,GRA7)
E61Y00302 1mg
EUR 700
ToX Antigen (P24,GRA1)
E61Y00305 1mg
EUR 700
TOX ELISA KIT|Human
EF005649 96 Tests
EUR 689
Human TOX ELISA KIT
ELI-51940h 96 Tests
EUR 824
Mouse Tox ELISA KIT
ELI-45511m 96 Tests
EUR 865
TOX Polyclonal Conjugated Antibody
C30803 100ul
EUR 397
TOX Antibody, HRP conjugated
1-CSB-PA024073LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TOX Antibody, FITC conjugated
1-CSB-PA024073LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TOX Antibody, Biotin conjugated
1-CSB-PA024073LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TOX. Recognizes TOX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Diphtheria Toxin (tox) Antibody
abx411295-01mg 0.1 mg
EUR 592
  • Shipped within 1 week.
Diphtheria Toxin (tox) Antibody
abx411297-1ml 1 ml
EUR 509
  • Shipped within 1 week.
Human TOX shRNA Plasmid
20-abx956525
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TOX shRNA Plasmid
20-abx982838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TOX Recombinant Protein (Rat)
RP234284 100 ug Ask for price
TOX Recombinant Protein (Human)
RP032593 100 ug Ask for price
TOX Recombinant Protein (Mouse)
RP180623 100 ug Ask for price
Thymocyte Selection-Associated High Mobility Group Box Protein TOX (TOX) Antibody
20-abx005337
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody
20-abx338585
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody (HRP)
20-abx337960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody (FITC)
20-abx337961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thymocyte selection-associated high mobility group box protein TOX (TOX) Antibody (Biotin)
20-abx337962
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Tox IgG ELISA Kit
EHT0037 96Tests
EUR 521
Human Tox IgM ELISA Kit
EHT0038 96Tests
EUR 521
Human Tox IgA ELISA Kit
EHT0039 96Tests
EUR 521
Human Tox IgD ELISA Kit
EHT0040 96Tests
EUR 521
Bovine Tox IgG ELISA Kit
EBT0037 96Tests
EUR 521
Bovine Tox IgM ELISA Kit
EBT0038 96Tests
EUR 521
Bovine Tox IgA ELISA Kit
EBT0039 96Tests
EUR 521
Bovine Tox IgD ELISA Kit
EBT0040 96Tests
EUR 521
Anserine Tox IgG ELISA Kit
EAT0037 96Tests
EUR 521
Anserine Tox IgM ELISA Kit
EAT0038 96Tests
EUR 521
Anserine Tox IgA ELISA Kit
EAT0039 96Tests
EUR 521
Anserine Tox IgD ELISA Kit
EAT0040 96Tests
EUR 521
Canine Tox IgG ELISA Kit
ECT0037 96Tests
EUR 521
Canine Tox IgM ELISA Kit
ECT0038 96Tests
EUR 521
Canine Tox IgA ELISA Kit
ECT0039 96Tests
EUR 521
Canine Tox IgD ELISA Kit
ECT0040 96Tests
EUR 521
Goat Tox IgG ELISA Kit
EGTT0037 96Tests
EUR 521
Goat Tox IgM ELISA Kit
EGTT0038 96Tests
EUR 521
Goat Tox IgA ELISA Kit
EGTT0039 96Tests
EUR 521
Goat Tox IgD ELISA Kit
EGTT0040 96Tests
EUR 521
Diphtheria Toxin (tox) Antibody (HRP)
abx411298-1ml 1 ml
EUR 634
  • Shipped within 1 week.
TOX Polyclonal Antibody, HRP Conjugated
A68732 100 ?g
EUR 628.55
Description: Ask the seller for details
TOX Polyclonal Antibody, FITC Conjugated
A68733 100 ?g
EUR 628.55
Description: The best epigenetics products
TOX Polyclonal Antibody, Biotin Conjugated
A68734 100 ?g
EUR 628.55
Description: kits suitable for this type of research
Porcine Tox IgG ELISA Kit
EPT0037 96Tests
EUR 521
Porcine Tox IgM ELISA Kit
EPT0038 96Tests
EUR 521
Porcine Tox IgA ELISA Kit
EPT0039 96Tests
EUR 521
Porcine Tox IgD ELISA Kit
EPT0040 96Tests
EUR 521
Rat Tox IgG ELISA Kit
ERT0037 96Tests
EUR 521
Rat Tox IgM ELISA Kit
ERT0038 96Tests
EUR 521
Rat Tox IgA ELISA Kit
ERT0039 96Tests
EUR 521
Rat Tox IgD ELISA Kit
ERT0040 96Tests
EUR 521
Rabbit Tox IgG ELISA Kit
ERTT0037 96Tests
EUR 521
Rabbit Tox IgM ELISA Kit
ERTT0038 96Tests
EUR 521
Rabbit Tox IgA ELISA Kit
ERTT0039 96Tests
EUR 521