BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

KDELR2

KDELR2 siRNA

20-abx902829
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KDELR2 siRNA

20-abx921380
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KDELR2 siRNA

20-abx921381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KDELR2 Antibody

1-CSB-PA003095
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KDELR2. Recognizes KDELR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

anti-KDELR2

YF-PA17362 100 ug
EUR 403
Description: Rabbit polyclonal to KDELR2

KDELR2 cloning plasmid

CSB-CL012130HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 639
  • Sequence: atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgta
  • Show more
Description: A cloning plasmid for the KDELR2 gene.

KDELR2 cloning plasmid

CSB-CL012130HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 639
  • Sequence: atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgta
  • Show more
Description: A cloning plasmid for the KDELR2 gene.

KDELR2 cloning plasmid

CSB-CL012130HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 561
  • Sequence: atgaacattttccggctgactggggacctgtcccacctggcggccatcgtcatcctgctgctgaagatctggaagacgcgctcctgcgccggtatttctgggaaaagccagcttctgtttgcactggtcttcacaactcgttacctggatctttttacttcatttatttcattgta
  • Show more
Description: A cloning plasmid for the KDELR2 gene.

KDELR2 Blocking Peptide

20-abx161658
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Mouse KDELR2 shRNA Plasmid

20-abx975856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat KDELR2 shRNA Plasmid

20-abx989261
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KDELR2 shRNA Plasmid

20-abx957523
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KDELR2 Recombinant Protein (Human)

RP016726 100 ug Ask for price

KDELR2 Recombinant Protein (Human)

RP016729 100 ug Ask for price

KDELR2 Recombinant Protein (Human)

RP016732 100 ug Ask for price

pENTR223-KDELR2-T11 vector

PVT11879 2 ug
EUR 304

KDELR2 Recombinant Protein (Rat)

RP207026 100 ug Ask for price

KDELR2 Recombinant Protein (Mouse)

RP145499 100 ug Ask for price

Polyclonal KDELR2 Antibody (aa100-150)

APR16989G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KDELR2 (aa100-150). This antibody is tested and proven to work in the following applications:

Polyclonal KDELR2 Antibody (aa81-130)

APR16990G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KDELR2 (aa81-130). This antibody is tested and proven to work in the following applications:

Polyclonal KDELR2 Antibody - middle region

APR16991G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KDELR2 - middle region. This antibody is tested and proven to work in the following applications:

KDELR2 ORF Vector (Human) (pORF)

ORF005576 1.0 ug DNA
EUR 95

KDELR2 ORF Vector (Human) (pORF)

ORF005577 1.0 ug DNA
EUR 95

KDELR2 ORF Vector (Human) (pORF)

ORF005578 1.0 ug DNA
EUR 95

Kdelr2 ORF Vector (Rat) (pORF)

ORF069010 1.0 ug DNA
EUR 506

Kdelr2 ORF Vector (Mouse) (pORF)

ORF048501 1.0 ug DNA
EUR 506

KDELR2 sgRNA CRISPR Lentivector set (Human)

K1128901 3 x 1.0 ug
EUR 339

Kdelr2 sgRNA CRISPR Lentivector set (Mouse)

K3516701 3 x 1.0 ug
EUR 339

Kdelr2 sgRNA CRISPR Lentivector set (Rat)

K6672801 3 x 1.0 ug
EUR 339

KDELR2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1128902 1.0 ug DNA
EUR 154

KDELR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1128903 1.0 ug DNA
EUR 154

KDELR2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1128904 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3516702 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3516703 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3516704 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6672802 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6672803 1.0 ug DNA
EUR 154

Kdelr2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6672804 1.0 ug DNA
EUR 154

KDELR2 Protein Vector (Human) (pPB-C-His)

PV022301 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-N-His)

PV022302 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-HA)

PV022303 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-His)

PV022304 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-C-His)

PV022305 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-N-His)

PV022306 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-HA)

PV022307 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-His)

PV022308 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-C-His)

PV022309 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPB-N-His)

PV022310 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-HA)

PV022311 500 ng
EUR 329

KDELR2 Protein Vector (Human) (pPM-C-His)

PV022312 500 ng
EUR 329

KDELR2 Protein Vector (Rat) (pPB-C-His)

PV276038 500 ng
EUR 603

KDELR2 Protein Vector (Rat) (pPB-N-His)

PV276039 500 ng
EUR 603

KDELR2 Protein Vector (Rat) (pPM-C-HA)

PV276040 500 ng
EUR 603

KDELR2 Protein Vector (Rat) (pPM-C-His)

PV276041 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPB-C-His)

PV194002 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPB-N-His)

PV194003 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPM-C-HA)

PV194004 500 ng
EUR 603

KDELR2 Protein Vector (Mouse) (pPM-C-His)

PV194005 500 ng
EUR 603

Kdelr2 3'UTR Luciferase Stable Cell Line

TU206651 1.0 ml Ask for price

Kdelr2 3'UTR GFP Stable Cell Line

TU160507 1.0 ml Ask for price

KDELR2 3'UTR Luciferase Stable Cell Line

TU011582 1.0 ml
EUR 1521

Kdelr2 3'UTR Luciferase Stable Cell Line

TU110507 1.0 ml Ask for price

KDELR2 3'UTR GFP Stable Cell Line

TU061582 1.0 ml
EUR 1521

Kdelr2 3'UTR GFP Stable Cell Line

TU256651 1.0 ml Ask for price

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679813 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679817 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679818 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711585 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711589 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711590 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711591 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711595 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711596 1.0 ug DNA
EUR 316

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

20-abx133035
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

abx028251-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

abx028251-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

KDEL Endoplasmic Reticulum Protein Retention Receptor 2 (KDELR2) Antibody

20-abx329427
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse ER lumen protein retaining receptor 2, Kdelr2 ELISA KIT

ELI-20492m 96 Tests
EUR 865

Chicken ER lumen protein retaining receptor 2, KDELR2 ELISA KIT

ELI-09240c 96 Tests
EUR 928

Human ER lumen protein retaining receptor 2, KDELR2 ELISA KIT

ELI-32782h 96 Tests
EUR 824

Bovine ER lumen protein retaining receptor 2, KDELR2 ELISA KIT

ELI-47279b 96 Tests
EUR 928

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1128905 3 x 1.0 ug
EUR 376

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3516705 3 x 1.0 ug
EUR 376

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6672805 3 x 1.0 ug
EUR 376

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1128906 1.0 ug DNA
EUR 167

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1128907 1.0 ug DNA
EUR 167

KDELR2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1128908 1.0 ug DNA
EUR 167

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3516706 1.0 ug DNA
EUR 167

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3516707 1.0 ug DNA
EUR 167

Kdelr2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3516708 1.0 ug DNA
EUR 167

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV679814 1.0 ug DNA
EUR 514

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV679815 1.0 ug DNA
EUR 572

KDELR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV679816 1.0 ug DNA
EUR 572

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV711586 1.0 ug DNA
EUR 316

KDELR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV711587 1.0 ug DNA
EUR 374

SEC24C

SEC24C siRNA
20-abx932778
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEC24C Antibody
1-CSB-PA020952GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SEC24C Antibody
1-CSB-PA020952LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is Unconjugated. Tested in the following application: ELISA
Human Protein transport protein Sec24C, SEC24C ELISA KIT
ELI-13439h 96 Tests
EUR 824
SEC24C cloning plasmid
CSB-CL020952HU-10ug 10ug
EUR 1204
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3285
  • Sequence: atgaacgtcaaccagtcagttccacctgtgccaccatttgggcagccccagcccatctacccagggtatcatcagtccagctatggtgggcaatcagggtccacagcccccgccattccctatggagcctacaatggcccagtaccaggctatcagcaaacacctccccaaggta
  • Show more
Description: A cloning plasmid for the SEC24C gene.
anti- SEC24C antibody
FNab07682 100µg
EUR 548.75
  • Immunogen: SEC24 family, member C(S. cerevisiae)
  • Uniprot ID: P53992
  • Gene ID: 9632
  • Research Area: Metabolism
Description: Antibody raised against SEC24C
SEC24C Rabbit pAb
A10797-100ul 100 ul
EUR 308
SEC24C Rabbit pAb
A10797-200ul 200 ul
EUR 459
SEC24C Rabbit pAb
A10797-20ul 20 ul
EUR 183
SEC24C Rabbit pAb
A10797-50ul 50 ul
EUR 223
SEC24C Polyclonal Antibody
A60838 100 µg
EUR 570.55
Description: reagents widely cited
SEC24C Rabbit pAb
A9159-100ul 100 ul
EUR 308
SEC24C Rabbit pAb
A9159-200ul 200 ul
EUR 459
SEC24C Rabbit pAb
A9159-20ul 20 ul Ask for price
SEC24C Rabbit pAb
A9159-50ul 50 ul Ask for price
SEC24C Polyclonal Antibody
27501-100ul 100ul
EUR 252
SEC24C Polyclonal Antibody
27501-50ul 50ul
EUR 187
Anti-SEC24C antibody
PAab07682 100 ug
EUR 386
pDONR223-SEC24C Plasmid
PVTB00920 2 ug
EUR 356
Anti-SEC24C Antibody
STJ502900 100 µg
EUR 476
Anti-SEC24C antibody
STJ111590 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified.
Anti-SEC24C antibody
STJ112693 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified.
Polyclonal SEC24C Antibody (Center)
AMM07743G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC24C (Center). This antibody is tested and proven to work in the following applications:
SEC24C Polyclonal Conjugated Antibody
C27501 100ul
EUR 397
SEC24C ELISA KIT|Human
EF002791 96 Tests
EUR 689
Human SEC24C shRNA Plasmid
20-abx956411
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEC24C Antibody, HRP conjugated
1-CSB-PA020952LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SEC24C Antibody, FITC conjugated
1-CSB-PA020952LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SEC24C Antibody, Biotin conjugated
1-CSB-PA020952LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC24C. Recognizes SEC24C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-SEC24C Antibody BIOTIN
STJ502901 100 µg
EUR 586
Anti-SEC24C Antibody FITC
STJ502902 100 µg
EUR 586
SEC24C Polyclonal Antibody, Biotin Conjugated
A60839 100 µg
EUR 570.55
Description: Ask the seller for details
SEC24C Polyclonal Antibody, FITC Conjugated
A60840 100 µg
EUR 570.55
Description: The best epigenetics products
SEC24C Polyclonal Antibody, HRP Conjugated
A60841 100 µg
EUR 570.55
Description: kits suitable for this type of research
SEC24C ORF Vector (Human) (pORF)
ORF009303 1.0 ug DNA
EUR 95
Sec24c ORF Vector (Mouse) (pORF)
ORF056859 1.0 ug DNA
EUR 506
Sec24c ORF Vector (Mouse) (pORF)
ORF056860 1.0 ug DNA
EUR 506
Sec24c ORF Vector (Rat) (pORF)
ORF075968 1.0 ug DNA
EUR 506
SEC24C sgRNA CRISPR Lentivector set (Human)
K2113701 3 x 1.0 ug
EUR 339
Sec24c sgRNA CRISPR Lentivector set (Mouse)
K4683701 3 x 1.0 ug
EUR 339
Sec24c sgRNA CRISPR Lentivector set (Rat)
K6600201 3 x 1.0 ug
EUR 339
SEC24C sgRNA CRISPR Lentivector (Human) (Target 1)
K2113702 1.0 ug DNA
EUR 154
SEC24C sgRNA CRISPR Lentivector (Human) (Target 2)
K2113703 1.0 ug DNA
EUR 154
SEC24C sgRNA CRISPR Lentivector (Human) (Target 3)
K2113704 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4683702 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4683703 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4683704 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Rat) (Target 1)
K6600202 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Rat) (Target 2)
K6600203 1.0 ug DNA
EUR 154
Sec24c sgRNA CRISPR Lentivector (Rat) (Target 3)
K6600204 1.0 ug DNA
EUR 154
SEC24C Protein Vector (Human) (pPB-C-His)
PV037209 500 ng
EUR 329
SEC24C Protein Vector (Human) (pPB-N-His)
PV037210 500 ng
EUR 329
SEC24C Protein Vector (Human) (pPM-C-HA)
PV037211 500 ng
EUR 329
SEC24C Protein Vector (Human) (pPM-C-His)
PV037212 500 ng
EUR 329
SEC24C Protein Vector (Rat) (pPB-C-His)
PV303870 500 ng
EUR 1191
SEC24C Protein Vector (Rat) (pPB-N-His)
PV303871 500 ng
EUR 1191
SEC24C Protein Vector (Rat) (pPM-C-HA)
PV303872 500 ng
EUR 1191
SEC24C Protein Vector (Rat) (pPM-C-His)
PV303873 500 ng
EUR 1191
SEC24C Protein Vector (Mouse) (pPB-C-His)
PV227434 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPB-N-His)
PV227435 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-HA)
PV227436 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-His)
PV227437 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPB-C-His)
PV227438 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPB-N-His)
PV227439 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-HA)
PV227440 500 ng
EUR 1065
SEC24C Protein Vector (Mouse) (pPM-C-His)
PV227441 500 ng
EUR 1065
Sec24c 3'UTR GFP Stable Cell Line
TU168502 1.0 ml Ask for price
SEC24C 3'UTR Luciferase Stable Cell Line
TU022840 1.0 ml
EUR 1521
Sec24c 3'UTR Luciferase Stable Cell Line
TU118502 1.0 ml Ask for price
SEC24C 3'UTR GFP Stable Cell Line
TU072840 1.0 ml
EUR 1521
Sec24c 3'UTR Luciferase Stable Cell Line
TU220064 1.0 ml Ask for price
Sec24c 3'UTR GFP Stable Cell Line
TU270064 1.0 ml Ask for price
Human SEC24 Family Member C (SEC24C) ELISA Kit
20-abx383088
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
for SEC24 Family, Member C (SEC24C)ELISA kit
SEP697Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for SEC24 Family, Member C (SEC24C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for SEC24 Family, Member C (SEC24C) in Tissue homogenates, cell lysates and other biological fluids.
ELISA Kit for SEC24 Family, Member C (SEC24C)
4-SEP697Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as SEC24 Family, Member C elisa. Alternative names of the recognized antigen: SEC24-related protein C
  • Protein transport protein Sec24C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of SEC24 Family, Member C (SEC24C) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
20-abx124157
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
20-abx126522
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx122216-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx032305-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx032305-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
abx237682-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SEC24 Homolog C, COPII Coat Complex Component (SEC24C) Antibody
20-abx305272
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

INO80D

INO80D siRNA

20-abx920632
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse INO80D shRNA Plasmid

20-abx981538
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human INO80D shRNA Plasmid

20-abx960300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ino80d ORF Vector (Rat) (pORF)

ORF068687 1.0 ug DNA
EUR 506

Ino80d ORF Vector (Mouse) (pORF)

ORF047957 1.0 ug DNA
EUR 506

Ino80d ORF Vector (Mouse) (pORF)

ORF047958 1.0 ug DNA
EUR 506

INO80D ORF Vector (Human) (pORF)

ORF021916 1.0 ug DNA
EUR 405

Ino80d sgRNA CRISPR Lentivector set (Rat)

K6200701 3 x 1.0 ug
EUR 339

INO80D sgRNA CRISPR Lentivector set (Human)

K1089201 3 x 1.0 ug
EUR 339

Ino80d sgRNA CRISPR Lentivector set (Mouse)

K4941301 3 x 1.0 ug
EUR 339

Ino80d sgRNA CRISPR Lentivector (Rat) (Target 1)

K6200702 1.0 ug DNA
EUR 154

Ino80d sgRNA CRISPR Lentivector (Rat) (Target 2)

K6200703 1.0 ug DNA
EUR 154

Ino80d sgRNA CRISPR Lentivector (Rat) (Target 3)

K6200704 1.0 ug DNA
EUR 154

INO80D sgRNA CRISPR Lentivector (Human) (Target 1)

K1089202 1.0 ug DNA
EUR 154

INO80D sgRNA CRISPR Lentivector (Human) (Target 2)

K1089203 1.0 ug DNA
EUR 154

INO80D sgRNA CRISPR Lentivector (Human) (Target 3)

K1089204 1.0 ug DNA
EUR 154

Ino80d sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4941302 1.0 ug DNA
EUR 154

Ino80d sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4941303 1.0 ug DNA
EUR 154

Ino80d sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4941304 1.0 ug DNA
EUR 154

INO80D Protein Vector (Human) (pPB-C-His)

PV087662 500 ng
EUR 811

INO80D Protein Vector (Human) (pPB-N-His)

PV087663 500 ng
EUR 811

INO80D Protein Vector (Human) (pPM-C-HA)

PV087664 500 ng
EUR 811

INO80D Protein Vector (Human) (pPM-C-His)

PV087665 500 ng
EUR 811

INO80D Protein Vector (Rat) (pPB-C-His)

PV274746 500 ng
EUR 1166

INO80D Protein Vector (Rat) (pPB-N-His)

PV274747 500 ng
EUR 1166

INO80D Protein Vector (Rat) (pPM-C-HA)

PV274748 500 ng
EUR 1166

INO80D Protein Vector (Rat) (pPM-C-His)

PV274749 500 ng
EUR 1166

INO80D Protein Vector (Mouse) (pPB-C-His)

PV191826 500 ng
EUR 1065

INO80D Protein Vector (Mouse) (pPB-N-His)

PV191827 500 ng
EUR 1065

INO80D Protein Vector (Mouse) (pPM-C-HA)

PV191828 500 ng
EUR 1065

INO80D Protein Vector (Mouse) (pPM-C-His)

PV191829 500 ng
EUR 1065

INO80D Protein Vector (Mouse) (pPB-C-His)

PV191830 500 ng
EUR 1065

INO80D Protein Vector (Mouse) (pPB-N-His)

PV191831 500 ng
EUR 1065

INO80D Protein Vector (Mouse) (pPM-C-HA)

PV191832 500 ng
EUR 1065

INO80D Protein Vector (Mouse) (pPM-C-His)

PV191833 500 ng
EUR 1065

Ino80d 3'UTR Luciferase Stable Cell Line

TU206305 1.0 ml Ask for price

Ino80d 3'UTR GFP Stable Cell Line

TU160130 1.0 ml Ask for price

INO80D 3'UTR Luciferase Stable Cell Line

TU011169 1.0 ml
EUR 4617

Ino80d 3'UTR Luciferase Stable Cell Line

TU110130 1.0 ml Ask for price

INO80D 3'UTR GFP Stable Cell Line

TU061169 1.0 ml
EUR 4617

Ino80d 3'UTR GFP Stable Cell Line

TU256305 1.0 ml Ask for price

Mouse INO80 complex subunit D, Ino80d ELISA KIT

ELI-39310m 96 Tests
EUR 865

Human INO80 complex subunit D, INO80D ELISA KIT

ELI-42100h 96 Tests
EUR 824

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6200705 3 x 1.0 ug
EUR 376

INO80D sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1089205 3 x 1.0 ug
EUR 376

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4941305 3 x 1.0 ug
EUR 376

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6200706 1.0 ug DNA
EUR 167

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6200707 1.0 ug DNA
EUR 167

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6200708 1.0 ug DNA
EUR 167

INO80D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1089206 1.0 ug DNA
EUR 167

INO80D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1089207 1.0 ug DNA
EUR 167

INO80D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1089208 1.0 ug DNA
EUR 167

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4941306 1.0 ug DNA
EUR 167

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4941307 1.0 ug DNA
EUR 167

Ino80d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4941308 1.0 ug DNA
EUR 167

H2AC13

Product not found

EIF2B1

EIF2B1 siRNA

20-abx901673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 Protein

20-abx263439
  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 antibody

70R-3849 50 ug
EUR 467
Description: Rabbit polyclonal EIF2B1 antibody raised against the C terminal of EIF2B1

EIF2B1 antibody

70R-17038 50 ul
EUR 435
Description: Rabbit polyclonal EIF2B1 antibody

EIF2B1 Antibody

DF12392 200ul
EUR 304
Description: EIF2B1 antibody detects endogenous levels of EIF2B1.

EIF2B1 Antibody

1-CSB-PA007514GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

EIF2B1 Antibody

1-CSB-PA623910ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF2B1 Antibody

1-CSB-PA623910ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-EIF2B1

YF-PA11516 50 ug
EUR 363
Description: Mouse polyclonal to EIF2B1

anti- EIF2B1 antibody

FNab02693 100µg
EUR 585
  • Immunogen: eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
  • Uniprot ID: Q14232
  • Gene ID: 1967
  • Research Area: Metabolism
Description: Antibody raised against EIF2B1

EIF2B1 Rabbit pAb

A7892-100ul 100 ul
EUR 308

EIF2B1 Rabbit pAb

A7892-200ul 200 ul
EUR 459

EIF2B1 Rabbit pAb

A7892-20ul 20 ul
EUR 183

EIF2B1 Rabbit pAb

A7892-50ul 50 ul
EUR 223

EIF2B1 Blocking Peptide

33R-1107 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACBD5 antibody, catalog no. 70R-6731

EIF2B1 Polyclonal Antibody

31370-100ul 100ul
EUR 252

EIF2B1 Polyclonal Antibody

31370-50ul 50ul
EUR 187

EIF2B1 Blocking Peptide

DF12392-BP 1mg
EUR 195

EIF2B1 cloning plasmid

CSB-CL623910HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: ATGGACGACAAGGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGAAGATCCTGACATGGCCTCAGCAGTGGCTGCCATCCGGACGTTGCTGGAGTTCTTGAAGAGAGATAAAGGGGAGACAATCCAGGGTCTGAGGGCGAATCTCACCAGTGCCATAGAAACCCTGTGTGGTGT
  • Show more
Description: A cloning plasmid for the EIF2B1 gene.

Anti-EIF2B1 antibody

PAab02693 100 ug
EUR 412

pExpress-Eif2b1-r

PVT17590 2 ug
EUR 258

Anti-EIF2B1 antibody

STJ110201 100 µl
EUR 277
Description: This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter.

EIF2B1 Polyclonal Conjugated Antibody

C31370 100ul
EUR 397

Mouse EIF2B1 shRNA Plasmid

20-abx980609
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EIF2B1 shRNA Plasmid

20-abx986264
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF2B1 ELISA KIT

ELI-09622h 96 Tests
EUR 824

Bovine EIF2B1 ELISA KIT

ELI-27647b 96 Tests
EUR 928

Mouse Eif2b1 ELISA KIT

ELI-27648m 96 Tests
EUR 865

EIF2B1 ELISA KIT|Human

EF009329 96 Tests
EUR 689

Human EIF2B1 shRNA Plasmid

20-abx951361
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF2B1 protein (His tag)

80R-1781 10 ug
EUR 305
Description: Purified recombinant Human EIF2B1 protein

EIF2B1 Recombinant Protein (Human)

RP038725 100 ug Ask for price

EIF2B1 Recombinant Protein (Rat)

RP199301 100 ug Ask for price

EIF2B1 Recombinant Protein (Mouse)

RP131213 100 ug Ask for price

Eif2b1 ORF Vector (Rat) (pORF)

ORF066435 1.0 ug DNA
EUR 506

Eif2b1 ORF Vector (Mouse) (pORF)

ORF043739 1.0 ug DNA
EUR 506

EIF2B1 ORF Vector (Human) (pORF)

ORF012909 1.0 ug DNA
EUR 354

EIF2B1 sgRNA CRISPR Lentivector set (Human)

K0665501 3 x 1.0 ug
EUR 339

Eif2b1 sgRNA CRISPR Lentivector set (Mouse)

K4892101 3 x 1.0 ug
EUR 339

Eif2b1 sgRNA CRISPR Lentivector set (Rat)

K7080801 3 x 1.0 ug
EUR 339

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0665502 1.0 ug DNA
EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0665503 1.0 ug DNA
EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0665504 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4892102 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4892103 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4892104 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7080802 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7080803 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7080804 1.0 ug DNA
EUR 154

EIF2B1 Protein Vector (Human) (pPB-C-His)

PV051633 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPB-N-His)

PV051634 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-HA)

PV051635 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-His)

PV051636 500 ng
EUR 481

EIF2B1 Protein Vector (Mouse) (pPB-C-His)

PV174954 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPB-N-His)

PV174955 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-HA)

PV174956 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-His)

PV174957 500 ng
EUR 603

Recombinant Human EIF2B1 Protein, GST, E.coli-100ug

QP7612-ec-100ug 100ug
EUR 408

Recombinant Human EIF2B1 Protein, GST, E.coli-10ug

QP7612-ec-10ug 10ug
EUR 200

Recombinant Human EIF2B1 Protein, GST, E.coli-1mg

QP7612-ec-1mg 1mg
EUR 1632

Recombinant Human EIF2B1 Protein, GST, E.coli-200ug

QP7612-ec-200ug 200ug
EUR 634

Recombinant Human EIF2B1 Protein, GST, E.coli-500ug

QP7612-ec-500ug 500ug
EUR 1060

Recombinant Human EIF2B1 Protein, GST, E.coli-50ug

QP7612-ec-50ug 50ug
EUR 263

EIF2B1 Protein Vector (Rat) (pPB-C-His)

PV265738 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPB-N-His)

PV265739 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-HA)

PV265740 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-His)

PV265741 500 ng
EUR 603

Eif2b1 3'UTR Luciferase Stable Cell Line

TU203867 1.0 ml Ask for price

GRPEL1

GRPEL1 antibody

70R-17610 50 ul
EUR 435
Description: Rabbit polyclonal GRPEL1 antibody

GRPEL1 antibody

70R-2425 50 ug
EUR 467
Description: Rabbit polyclonal GRPEL1 antibody

GRPEL1 Antibody

1-CSB-PA875707ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL1. Recognizes GRPEL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GRPEL1 Antibody

1-CSB-PA875707ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL1. Recognizes GRPEL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GRPEL1 Antibody

1-CSB-PA009941GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GRPEL1. Recognizes GRPEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

GRPEL1 siRNA

20-abx902338
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRPEL1 siRNA

20-abx918744
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRPEL1 siRNA

20-abx918745
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GRPEL1

YF-PA21061 50 ug
EUR 363
Description: Mouse polyclonal to GRPEL1

GRPEL1 Polyclonal Antibody

30632-100ul 100ul
EUR 252

GRPEL1 Polyclonal Antibody

30632-50ul 50ul
EUR 187

GRPEL1 Blocking Peptide

33R-6876 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRPEL1 antibody, catalog no. 70R-2425

GRPEL1 cloning plasmid

CSB-CL875707HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggcggctcagtgcgtgaggttggcgcggcgcagtcttcctgctttggcgttgtctctcaggccatctccccggttgttgtgcacagccacgaaacaaaagaacagtggccagaacctggaagaggacatgggtcagagtgaacagaaggcagatcctcctgctacagagaagac
  • Show more
Description: A cloning plasmid for the GRPEL1 gene.

GRPEL1 Rabbit pAb

A4999-100ul 100 ul
EUR 308

GRPEL1 Rabbit pAb

A4999-200ul 200 ul
EUR 459

GRPEL1 Rabbit pAb

A4999-20ul 20 ul
EUR 183

GRPEL1 Rabbit pAb

A4999-50ul 50 ul
EUR 223

anti- GRPEL1 antibody

FNab03666 100µg
EUR 548.75
  • Immunogen: GrpE-like 1, mitochondrial(E. coli)
  • Uniprot ID: Q9HAV7
  • Gene ID: 80273
  • Research Area: Metabolism
Description: Antibody raised against GRPEL1

Anti-GRPEL1 antibody

PAab03666 100 ug
EUR 386

Anti-GRPEL1 antibody

STJ27014 100 µl
EUR 277

GRPEL1 protein (His tag)

80R-1507 50 ug
EUR 305
Description: Purified recombinant Human GRPEL1 protein

GRPEL1 ELISA KIT|Human

EF010004 96 Tests
EUR 689

Mouse GRPEL1 shRNA Plasmid

20-abx971590
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GRPEL1 shRNA Plasmid

20-abx986561
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRPEL1 Polyclonal Conjugated Antibody

C30632 100ul
EUR 397

Human GRPEL1 shRNA Plasmid

20-abx962833
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRPEL1 Recombinant Protein (Human)

RP014062 100 ug Ask for price

GRPEL1 Recombinant Protein (Rat)

RP203759 100 ug Ask for price

GRPEL1 Recombinant Protein (Mouse)

RP140108 100 ug Ask for price

Grpel1 ORF Vector (Rat) (pORF)

ORF067921 1.0 ug DNA
EUR 506

GRPEL1 ORF Vector (Human) (pORF)

ORF004688 1.0 ug DNA
EUR 95

Grpel1 ORF Vector (Mouse) (pORF)

ORF046704 1.0 ug DNA
EUR 506

Grpel1 sgRNA CRISPR Lentivector set (Mouse)

K4800401 3 x 1.0 ug
EUR 339

Grpel1 sgRNA CRISPR Lentivector set (Rat)

K7012501 3 x 1.0 ug
EUR 339

GRPEL1 sgRNA CRISPR Lentivector set (Human)

K0909701 3 x 1.0 ug
EUR 339

Human GrpE protein homolog 1, mitochondrial (GRPEL1)

1-CSB-EP875707HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human GrpE protein homolog 1, mitochondrial(GRPEL1) expressed in E.coli

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

20-abx003814
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

20-abx112867
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx036628-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx029915-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx029915-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

abx233666-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

20-abx321969
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GrpE Protein Homolog 1, Mitochondrial (GRPEL1) Antibody

20-abx321970
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Grpel1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4800402 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4800403 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4800404 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7012502 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7012503 1.0 ug DNA
EUR 154

Grpel1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7012504 1.0 ug DNA
EUR 154

GRPEL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0909702 1.0 ug DNA
EUR 154

GRPEL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0909703 1.0 ug DNA
EUR 154

GRPEL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0909704 1.0 ug DNA
EUR 154

GRPEL1 GrpE-Like 1 Human Recombinant Protein

PROTQ9HAV7 Regular: 10ug
EUR 317
Description: GRPEL1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 211 amino acids (28-217a.a.) and having a molecular mass of 23.6kDa.;GRPEL1 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GRPEL1 Protein Vector (Rat) (pPB-C-His)

PV271682 500 ng
EUR 603

GRPEL1 Protein Vector (Rat) (pPB-N-His)

PV271683 500 ng
EUR 603

GRPEL1 Protein Vector (Rat) (pPM-C-HA)

PV271684 500 ng
EUR 603

GRPEL1 Protein Vector (Rat) (pPM-C-His)

PV271685 500 ng
EUR 603

GRPEL1 Protein Vector (Mouse) (pPB-C-His)

PV186814 500 ng
EUR 603

GRPEL1 Protein Vector (Mouse) (pPB-N-His)

PV186815 500 ng
EUR 603