VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]



ABD2989 100 ug
EUR 438

Phospho- RIP3 (phospho S232) Antibody

ABF3805 100 ug
EUR 438

phospho-Marcks (phospho-Marcks) Antibody

abx236404-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

phospho-Marcks (phospho-Marcks) Antibody

abx236405-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

phospho-Akt1 (Phospho-Ser479) Antibody

12891-100ul 100ul
EUR 252

phospho-Akt1 (Phospho-Ser479) Antibody

12891-50ul 50ul
EUR 187

IRE1 (Phospho-phospho S724) Antibody

13013-100ul 100ul
EUR 252

IRE1 (Phospho-phospho S724) Antibody

13013-50ul 50ul
EUR 187

IRE1 (Phospho-phospho Y628) Antibody

13014-100ul 100ul
EUR 252

IRE1 (Phospho-phospho Y628) Antibody

13014-50ul 50ul
EUR 187

MSK1(Phospho-phospho S376) Antibody

13389-100ul 100ul
EUR 333

MSK1(Phospho-phospho S376) Antibody

13389-50ul 50ul
EUR 239

PAK1(Phospho-S144)+PAK2(Phospho-S141)+PAK3(Phospho-S139) Antibody

13363-100ul 100ul
EUR 333

PAK1(Phospho-S144)+PAK2(Phospho-S141)+PAK3(Phospho-S139) Antibody

13363-50ul 50ul
EUR 239

MSK1(Phospho-phospho S376) Conjugated Antibody

C13389 100ul
EUR 397

RPA32/RPA2 (Phospho-phospho T21) Antibody

13390-100ul 100ul
EUR 333

RPA32/RPA2 (Phospho-phospho T21) Antibody

13390-50ul 50ul
EUR 239


EF018210 96 Tests
EUR 689

Phospho- Catenin-

ABF3266 100 ug
EUR 438

Phospho- NF-

ABF3375 100 ug
EUR 438

Phospho- AMPK

ABF3494 100 ug
EUR 438

Phospho- IKK-

ABF3496 100 ug
EUR 438

Phospho- AMPK

ABF3514 100 ug
EUR 438

Phospho- Catenin

ABF3541 100 ug
EUR 438

Phospho- Catenin

ABF3542 100 ug
EUR 438

Phospho- Catenin

ABF3543 100 ug
EUR 438

Phospho- HSP90

ABF3615 100 ug
EUR 438

Phospho- IKK

ABF3618 100 ug
EUR 438

Phospho- PKC

ABF3700 100 ug
EUR 438

Phospho- PLC

ABF3704 100 ug
EUR 438

Phospho- PTP

ABF3717 100 ug
EUR 438

Phospho- PLC-

ABF5852 100 ug
EUR 438

Phospho- PLC-

ABF5853 100 ug
EUR 438

Phospho- IKK

ABF9243 100 ug
EUR 438

Phospho- PP1

ABD2990 100 ug
EUR 438


MO22150 100 ul
EUR 435

PAK1(Phospho-S144)+PAK2(Phospho-S141)+PAK3(Phospho-S139) Conjugated Antibody

C13363 100ul
EUR 397

RPA32/RPA2 (Phospho-phospho T21) Conjugated Antibody

C13390 100ul
EUR 397

phospho-Akt1 (Phospho-Ser479) Polyclonal Conjugated Antibody

C12891 100ul
EUR 397

IRE1 (Phospho-phospho S724) Polyclonal Conjugated Antibody

C13013 100ul
EUR 397

IRE1 (Phospho-phospho Y628) Polyclonal Conjugated Antibody

C13014 100ul
EUR 397

ZIPK-Phospho 311Ser (ZIPK-Phospho 311Ser) Antibody

abx239644-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phospho Histone H1 (Phospho Thr3) Polyclonal Antibody

A68359 100 µg
EUR 483.55
Description: kits suitable for this type of research

Phospho-Mst1(Thr183)/Mst2 (Phospho-Thr180) Antibody

Ab17467-100 100ul
EUR 482

Erk1(Phospho-T202)+Erk2(Phospho-T185) Antibody

13340-100ul 100ul
EUR 333

Erk1(Phospho-T202)+Erk2(Phospho-T185) Antibody

13340-50ul 50ul
EUR 239

Anti-Myosin phospho S19/phospho S20 Antibody

P11637-1 100uL
EUR 455
Description: Rabbit Polyclonal Myosin phospho S19/phospho S20 Antibody. Validated in IP, WB and tested in Human.

anti-EGFR (Phospho-Tyr1197)/Her2(Phospho-Tyr1248)

LF-PA0082 100 ul
EUR 334
Description: Rabbit polyclonal to EGFR (Phospho-Tyr1197)/Her2(Phospho-Tyr1248)

Anti-Phospho-Thr356 PRAS40 Antibody, Phospho-Specific

P03629 100ul
EUR 398
Description: Rabbit Polyclonal Phospho-Thr356 PRAS40 Antibody, Phospho-Specific. Validated in WB and tested in Drosophila.

Erk1(Phospho-T202)+Erk2(Phospho-T185) Conjugated Antibody

C13340 100ul
EUR 397

Histone H1.3 (Phospho-Thr17) +H1.4 (Phospho-Thr17) Antibody

12793-100ul 100ul
EUR 252

Histone H1.3 (Phospho-Thr17) +H1.4 (Phospho-Thr17) Antibody

12793-50ul 50ul
EUR 187

Kemptide (Phospho-Ser5)

HY-P0291 10mg
EUR 1165

Phospho- PKD1/PKC

ABF3443 100 ug
EUR 438

Phospho- C/EBP

ABF3536 100 ug
EUR 438


Anti-Human CD33 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01508-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 195
Description: Mouse Monoclonal Human CD33 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC02675-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 160
Description: Mouse Monoclonal Human CD3 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD10 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC04065-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 166
Description: Mouse Monoclonal human CD10 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01340-PE-Cy7 25tests, 100tests, 200tests
EUR 188
Description: Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-PE-Cy7 25ug, 100ug
EUR 137
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-2-PE-Cy7 25ug, 100ug
EUR 131
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-Mouse Ly-6G (Gr-1) Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC30404-1-PE-Cy7 25ug, 100ug
EUR 131
Description: Rat Monoclonal Mouse Ly-6G (Gr-1) Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Mouse IgG-PE conjugate (isotype control)

20008-PE 50 Tests
EUR 164

Rabbit IgG-PE conjugate (isotype control)

20009-PE 100 tests
EUR 225

Goat IgG-PE conjugate (isotype control)

20011-PE 100 tests
EUR 225

Monoclonal Anti-Rat IgG1-PE Conjugate

50126-PE 0.1 ml
EUR 347

CD11a antibody (PE-CY7)

61R-CD11aaMSPE7 100 ug
EUR 435
Description: Rat monoclonal CD11a antibody (PE-CY7)

CD16 antibody (PE-CY7)

61R-CD16gMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD16 antibody (PE-CY7)

CD19 antibody (PE-CY7)

61R-CD19aMSPEC7 100 ug
EUR 327
Description: Rat monoclonal CD19 antibody (PE-CY7)

CD19 antibody (PE-CY7)

61R-CD19cHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD19 antibody (PE-CY7)

CD20 antibody (PE-CY7)

61R-CD20bHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD20 antibody (PE-CY7)

CD23 antibody (PE-CY7)

61R-CD23cMSPEC7 100 ug
EUR 327
Description: Rat monoclonal CD23 antibody (PE-CY7)

CD25 antibody (PE-CY7)

61R-CD25cMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD25 antibody (PE-CY7)

CD25 antibody (PE-CY7)

61R-CD25dMSPEC7 100 ug
EUR 370
Description: Rat monoclonal CD25 antibody (PE-CY7)

CD31 antibody (PE-CY7)

61R-CD31jMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD31 antibody (PE-CY7)

CD3 antibody (PE-CY7)

61R-CD3gHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD3 antibody (PE-CY7)

CD44 antibody (PE-CY7)

61R-CD44hHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD44 antibody (PE-CY7)

CD45.1 antibody (PE-CY7)

61R-CD45gMSPEC7 100 ug
EUR 300
Description: Mouse monoclonal CD45.1 antibody (PE-CY7)

CD45.2 antibody (PE-CY7)

61R-CD45hMSAPC7 100 ug
EUR 316
Description: Mouse monoclonal CD45.2 antibody (PE-CY7)

CD45R antibody (PE-CY7)

61R-CD45RcMSPE7 100 ug
EUR 300
Description: Rat monoclonal CD45R antibody (PE-CY7)

CD4 antibody (PE-CY7)

61R-CD4eMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD4 antibody (PE-CY7)

CD4 antibody (PE-CY7)

61R-CD4kHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD4 antibody (PE-CY7)

CD62L antibody (PE-CY7)

61R-CD62dMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD62L antibody (PE-CY7)

CD69 antibody (PE-CY7)

61R-CD69aMSPEC 100 ug
EUR 300
Description: Hamster monoclonal CD69 antibody (PE-CY7)

CD86 antibody (PE-CY7)

61R-CD86bMSPEC7 100 ug
EUR 370
Description: Rat monoclonal CD86 antibody (PE-CY7)

CD86 antibody (PE-CY7)

61R-CD86cMSPEC7 100 ug
EUR 403
Description: Rat monoclonal CD86 antibody (PE-CY7)

CD8a antibody (PE-CY7)

61R-CD8abMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD8a antibody (PE-CY7)

Streptavidin-PE-Cy7 conjugate

SV-PEC7-100 100 tests
EUR 286

Anti-EGFR PE-Cy7

T7-680-T025 25 tests
EUR 154

Anti-EGFR PE-Cy7

T7-680-T100 100 tests
EUR 268

Anti-Helios PE-Cy7

T7-771-T025 25 tests
EUR 154

Anti-Helios PE-Cy7

T7-771-T100 100 tests
EUR 268

Rat IgG-PE conjugate (isotype control) (Isotype control)

20005-PE 25 tests
EUR 202

Anti-Human CD44 Monoclonal Antibody PE Conjugated, Flow Validated

FC00052-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human CD44 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD28 Monoclonal Antibody PE Conjugated, Flow Validated

FC00065-PE 25 tests, 100 tests
EUR 143
Description: Mouse Monoclonal Human CD28 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD40 Monoclonal Antibody PE Conjugated, Flow Validated

FC00068-PE 25 Tests, 100 Tests, 200 Tests
EUR 149
Description: Anti-Human CD40 Monoclonal Antibody PE Conjugated, Flow Validated

Anti-human CD14 Monoclonal Antibody PE Conjugated, Flow Validated

FC00137-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD14 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD11b Monoclonal Antibody PE Conjugated, Flow Validated

FC00144-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD11b Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD19 Monoclonal Antibody PE Conjugated, Flow Validated

FC00154-PE 25 Tests, 100 Tests, 200 Tests
EUR 108
Description: Mouse Monoclonal human CD19 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

FC00171-PE 25 Tests, 100 Tests, 200 Tests
EUR 142
Description: Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

Anti-human CD38 Monoclonal Antibody PE Conjugated, Flow Validated

FC00193-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD38 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD25 Monoclonal Antibody PE Conjugated, Flow Validated

FC00214-PE 25 Tests, 100 Tests, 200 Tests
EUR 125
Description: Mouse Monoclonal human CD25 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD86 Monoclonal Antibody PE Conjugated, Flow Validated

FC00220-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human CD86 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD4 Monoclonal Antibody PE Conjugated, Flow Validated

FC00344-PE 25 Tests, 100 Tests, 200 Tests
EUR 113
Description: Mouse Monoclonal human CD4 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD11c Monoclonal Antibody PE Conjugated, Flow Validated

FC00357-PE 25 Tests
EUR 136
Description: Mouse Monoclonal Human CD11c Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD5 Monoclonal Antibody PE Conjugated, Flow Validated

FC00480-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Anti-human CD5 PE Conjugated, designed for Flow Cytometry and validated by Flow Cytometry using Human cells.

Anti-human CD45 Monoclonal Antibody PE Conjugated, Flow Validated

FC00555-PE 25 Tests, 100 Tests, 200 Tests
EUR 118
Description: Mouse Monoclonal human CD45 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD2 Monoclonal Antibody PE Conjugated, Flow Validated

FC00570-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD2 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD71 Monoclonal Antibody PE Conjugated, Flow Validated

FC00591-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD71 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD62L Monoclonal Antibody PE Conjugated, Flow Validated

FC00652-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD62L Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

pg esam

Progesterone (Pg) ELISA Kit

DLR-Pg-Ge-96T 96T
EUR 608
  • Should the Progesterone (Pg) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Progesterone (Pg) in samples from serum, plasma or other biological fluids.

General Progesterone (Pg) ELISA Kit

RDR-Pg-Ge-48Tests 48 Tests
EUR 488

General Progesterone (Pg) ELISA Kit

RDR-Pg-Ge-96Tests 96 Tests
EUR 676

General Progesterone (Pg) ELISA Kit

RD-Pg-Ge-48Tests 48 Tests
EUR 467

General Progesterone (Pg) ELISA Kit

RD-Pg-Ge-96Tests 96 Tests
EUR 646

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

EUR 517
  • Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

EUR 673
  • Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-48Tests 48 Tests
EUR 544

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RDR-ESAM-Hu-96Tests 96 Tests
EUR 756

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-48Tests 48 Tests
EUR 521

Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit

RD-ESAM-Hu-96Tests 96 Tests
EUR 723

Esam/ Rat Esam ELISA Kit

ELI-20559r 96 Tests
EUR 886

ESAM antibody

70R-17149 50 ul
EUR 435
Description: Rabbit polyclonal ESAM antibody

ESAM Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ESAM Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21677 50 ug
EUR 363
Description: Mouse polyclonal to ESAM


YF-PA21678 100 ul
EUR 403
Description: Rabbit polyclonal to ESAM


YF-PA21679 100 ug
EUR 403
Description: Rabbit polyclonal to ESAM


36700 1 mg
EUR 480
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

PG 106

B5768-1 1 mg
EUR 480

PG 931

B5807-1 1 mg
EUR 486

PG 01

B7545-10 10 mg
EUR 334

PG 01

B7545-50 50 mg
EUR 1243


PVT11382 2 ug
EUR 370

ESAM Polyclonal Antibody

27645-100ul 100ul
EUR 252

ESAM Polyclonal Antibody

27645-50ul 50ul
EUR 187

ESAM Rabbit pAb

A12210-100ul 100 ul
EUR 308

ESAM Rabbit pAb

A12210-200ul 200 ul
EUR 459

ESAM Rabbit pAb

A12210-20ul 20 ul
EUR 183

ESAM Rabbit pAb

A12210-50ul 50 ul
EUR 223

ESAM Polyclonal Antibody

ABP58502-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM Polyclonal Antibody

ABP58502-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ESAM protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein

ESAM cloning plasmid

CSB-CL850258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg
  • Show more
Description: A cloning plasmid for the ESAM gene.

ESAM Polyclonal Antibody

A55335 100 µg
EUR 570.55
Description: kits suitable for this type of research

ESAM Polyclonal Antibody

ES11142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESAM Polyclonal Antibody

ES11142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- ESAM antibody

FNab02860 100µg
EUR 548.75
  • Immunogen: endothelial cell adhesion molecule
  • Uniprot ID: Q96AP7
  • Gene ID: 90952
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against ESAM

Anti-ESAM antibody

PAab02860 100 ug
EUR 386

Anti-ESAM antibody

STJ114102 100 µl
EUR 277

Anti-ESAM antibody

STJ192300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ESAM

Anti-ESAM (1G8)

YF-MA19632 100 ug
EUR 363
Description: Mouse monoclonal to ESAM

Anti-ESAM (1E4)

YF-MA19633 100 ug
EUR 363
Description: Mouse monoclonal to ESAM


ELA-E0165r 96 Tests
EUR 886

PG-E2/ Rat PG- E2 ELISA Kit

ELA-E0538r 96 Tests
EUR 886

PG-E1/ Rat PG- E1 Elisa Kit

ELA-E0904r 96 Tests
EUR 886

Human versican/PG-M/PG-350 ELISA kit

CSB-E11884h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human versican/PG-M/PG-350 in samples from serum, cell culture supernates, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human versican/PG-M/PG-350 ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human versican/PG-M/PG-350 in samples from serum, cell culture supernates, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

PG-9 maleate

B6435-10 10 mg
EUR 268

PG-9 maleate

B6435-50 50 mg
EUR 973

Progesterone (PG) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1080.00
  • EUR 537.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PG 01037 dihydrochloride

B7524-10 10 mg
EUR 258

pe cy5

PE-Cy5 (Phycoerhthrin-Cy5 Conjugate)

EUR 370

PE-Cy5 Tandem

2610 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Hamster IgG-Cy5 conjugate, isotype control (Syrian)

20003-1-Cy5 50 tests
EUR 225

Goat IgG F(ab')2 fragment-Cy5 conjugate

20011-FAB2-Cy5 50 tests
EUR 202

PE-Cy5 Calibration Kit

ECFP-F4-5K 5X1 mL
EUR 310
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

CD45RO Antibody (PE-Cy5)

abx134008-100Assays 100 Assays
EUR 495
  • Shipped within 5-10 working days.

CD45RO Antibody (PE-Cy5)

abx134008-50Assays 50 Assays
EUR 398
  • Shipped within 5-10 working days.

Annexin V-PE-Cy5 Reagent

EUR 1132

Annexin V-PE-Cy5 Reagent

EUR 403

Anti-Hu CD15 PE-Cy5

T8-138-T100 100 tests
EUR 240

Anti-Hu CD184 PE-Cy5

T8-146-T100 100 tests
EUR 240

Anti-Hu CD45 PE-Cy5

T8-160-T100 100 tests
EUR 240

Anti-Hu CD7 PE-Cy5

T8-183-T025 25 tests
EUR 140

Anti-Hu CD7 PE-Cy5

T8-183-T100 100 tests
EUR 240

Anti-Hu CD8 PE-Cy5

T8-207-T025 25 tests
EUR 140

Anti-Hu CD8 PE-Cy5

T8-207-T100 100 tests
EUR 240

Anti-Hu CD10 PE-Cy5

T8-209-T025 25 tests
EUR 140

Anti-Hu CD10 PE-Cy5

T8-209-T100 100 tests
EUR 240

Anti-Hu CD45 PE-Cy5

T8-222-T025 25 tests
EUR 140

Anti-Hu CD45 PE-Cy5

T8-222-T100 100 tests
EUR 240

Anti-Hu CD55 PE-Cy5

T8-230-T025 25 tests
EUR 140

Anti-Hu CD55 PE-Cy5

T8-230-T100 100 tests
EUR 240

Anti-Hu CD56 PE-Cy5

T8-231-T025 25 tests
EUR 140

Anti-Hu CD56 PE-Cy5

T8-231-T100 100 tests
EUR 240

Anti-Hu CD31 PE-Cy5

T8-273-T025 25 tests
EUR 140

Anti-Hu CD31 PE-Cy5

T8-273-T100 100 tests
EUR 240

Anti-Hu CD80 PE-Cy5

T8-287-T025 25 tests
EUR 140

Anti-Hu CD80 PE-Cy5

T8-287-T100 100 tests
EUR 240

Anti-Hu CD14 PE-Cy5

T8-293-T025 25 tests
EUR 140

Anti-Hu CD14 PE-Cy5

T8-293-T100 100 tests
EUR 240

Anti-Hu CD21 PE-Cy5

T8-306-T025 25 tests
EUR 140

Anti-Hu CD21 PE-Cy5

T8-306-T100 100 tests
EUR 240

Anti-Hu CD27 PE-Cy5

T8-308-T025 25 tests
EUR 140

Anti-Hu CD27 PE-Cy5

T8-308-T100 100 tests
EUR 240

Anti-Hu CD41 PE-Cy5

T8-309-T025 25 tests
EUR 140

Anti-Hu CD41 PE-Cy5

T8-309-T100 100 tests
EUR 240

Anti-Hu IgM PE-Cy5

T8-320-C025 0.025 mg
EUR 126

Anti-Hu IgM PE-Cy5

T8-320-C100 0.1 mg
EUR 213

Anti-Hu IgE PE-Cy5

T8-324-C025 0.025 mg
EUR 126

Anti-Hu IgE PE-Cy5

T8-324-C100 0.1 mg
EUR 213

Anti-Hu CD63 PE-Cy5

T8-343-T025 25 tests
EUR 140

Anti-Hu CD63 PE-Cy5

T8-343-T100 100 tests
EUR 240

Anti-Hu CD4 PE-Cy5

T8-359-T025 25 tests
EUR 140

Anti-Hu CD4 PE-Cy5

T8-359-T100 100 tests
EUR 240

Anti-Hu CD38 PE-Cy5

T8-366-T025 25 tests
EUR 140

Anti-Hu CD38 PE-Cy5

T8-366-T100 100 tests
EUR 240

Anti-Hu CD3 PE-Cy5

T8-514-T025 25 tests
EUR 140

Anti-Hu CD3 PE-Cy5

T8-514-T100 100 tests
EUR 240

Anti-Hu CD86 PE-Cy5

T8-531-T025 25 tests
EUR 140

Anti-Hu CD86 PE-Cy5

T8-531-T100 100 tests
EUR 240

Anti-Hu CD117 PE-Cy5

T8-586-T025 25 tests
EUR 140

Anti-Hu CD117 PE-Cy5

T8-586-T100 100 tests
EUR 240

Anti-Hu CD158d PE-Cy5

T8-609-T100 100 tests
EUR 240

Anti-Hu CD20 PE-Cy5

T8-638-T025 25 tests
EUR 140

Anti-Hu CD20 PE-Cy5

T8-638-T100 100 tests
EUR 240

pe cy7

Anti-Human CD33 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01508-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 195
Description: Mouse Monoclonal Human CD33 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD3 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC02675-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 160
Description: Mouse Monoclonal Human CD3 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD10 Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC04065-PE-Cy7 25 Tests, 100 Tests, 200 Tests
EUR 166
Description: Mouse Monoclonal human CD10 Antibody PE-Cy7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

FC01340-PE-Cy7 25tests, 100tests, 200tests
EUR 188
Description: Anti-Human HLA-DR Monoclonal Antibody PE-Cy7 Conjugated, Flow Validated

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-PE-Cy7 25ug, 100ug
EUR 137
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-Mouse CD4 Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC00344-2-PE-Cy7 25ug, 100ug
EUR 131
Description: Rat Monoclonal Mouse CD4 Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Anti-Mouse Ly-6G (Gr-1) Monoclonal Antibody PE-Cyanine7 Conjugated, Flow Validated

FC30404-1-PE-Cy7 25ug, 100ug
EUR 131
Description: Rat Monoclonal Mouse Ly-6G (Gr-1) Antibody PE-Cyanine7 Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Mouse.

Mouse IgG-PE conjugate (isotype control)

20008-PE 50 Tests
EUR 164

Rabbit IgG-PE conjugate (isotype control)

20009-PE 100 tests
EUR 225

Goat IgG-PE conjugate (isotype control)

20011-PE 100 tests
EUR 225

Monoclonal Anti-Rat IgG1-PE Conjugate

50126-PE 0.1 ml
EUR 347

CD11a antibody (PE-CY7)

61R-CD11aaMSPE7 100 ug
EUR 435
Description: Rat monoclonal CD11a antibody (PE-CY7)

CD16 antibody (PE-CY7)

61R-CD16gMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD16 antibody (PE-CY7)

CD19 antibody (PE-CY7)

61R-CD19aMSPEC7 100 ug
EUR 327
Description: Rat monoclonal CD19 antibody (PE-CY7)

CD19 antibody (PE-CY7)

61R-CD19cHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD19 antibody (PE-CY7)

CD20 antibody (PE-CY7)

61R-CD20bHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD20 antibody (PE-CY7)

CD23 antibody (PE-CY7)

61R-CD23cMSPEC7 100 ug
EUR 327
Description: Rat monoclonal CD23 antibody (PE-CY7)

CD25 antibody (PE-CY7)

61R-CD25cMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD25 antibody (PE-CY7)

CD25 antibody (PE-CY7)

61R-CD25dMSPEC7 100 ug
EUR 370
Description: Rat monoclonal CD25 antibody (PE-CY7)

CD31 antibody (PE-CY7)

61R-CD31jMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD31 antibody (PE-CY7)

CD3 antibody (PE-CY7)

61R-CD3gHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD3 antibody (PE-CY7)

CD44 antibody (PE-CY7)

61R-CD44hHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD44 antibody (PE-CY7)

CD45.1 antibody (PE-CY7)

61R-CD45gMSPEC7 100 ug
EUR 300
Description: Mouse monoclonal CD45.1 antibody (PE-CY7)

CD45.2 antibody (PE-CY7)

61R-CD45hMSAPC7 100 ug
EUR 316
Description: Mouse monoclonal CD45.2 antibody (PE-CY7)

CD45R antibody (PE-CY7)

61R-CD45RcMSPE7 100 ug
EUR 300
Description: Rat monoclonal CD45R antibody (PE-CY7)

CD4 antibody (PE-CY7)

61R-CD4eMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD4 antibody (PE-CY7)

CD4 antibody (PE-CY7)

61R-CD4kHUPEC7 100 tests
EUR 446
Description: Mouse monoclonal CD4 antibody (PE-CY7)

CD62L antibody (PE-CY7)

61R-CD62dMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD62L antibody (PE-CY7)

CD69 antibody (PE-CY7)

61R-CD69aMSPEC 100 ug
EUR 300
Description: Hamster monoclonal CD69 antibody (PE-CY7)

CD86 antibody (PE-CY7)

61R-CD86bMSPEC7 100 ug
EUR 370
Description: Rat monoclonal CD86 antibody (PE-CY7)

CD86 antibody (PE-CY7)

61R-CD86cMSPEC7 100 ug
EUR 403
Description: Rat monoclonal CD86 antibody (PE-CY7)

CD8a antibody (PE-CY7)

61R-CD8abMSPEC7 100 ug
EUR 300
Description: Rat monoclonal CD8a antibody (PE-CY7)

Streptavidin-PE-Cy7 conjugate

SV-PEC7-100 100 tests
EUR 286

Anti-EGFR PE-Cy7

T7-680-T025 25 tests
EUR 154

Anti-EGFR PE-Cy7

T7-680-T100 100 tests
EUR 268

Anti-Helios PE-Cy7

T7-771-T025 25 tests
EUR 154

Anti-Helios PE-Cy7

T7-771-T100 100 tests
EUR 268

Rat IgG-PE conjugate (isotype control) (Isotype control)

20005-PE 25 tests
EUR 202

Anti-Human CD44 Monoclonal Antibody PE Conjugated, Flow Validated

FC00052-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human CD44 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD28 Monoclonal Antibody PE Conjugated, Flow Validated

FC00065-PE 25 tests, 100 tests
EUR 143
Description: Mouse Monoclonal Human CD28 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD40 Monoclonal Antibody PE Conjugated, Flow Validated

FC00068-PE 25 Tests, 100 Tests, 200 Tests
EUR 149
Description: Anti-Human CD40 Monoclonal Antibody PE Conjugated, Flow Validated

Anti-human CD14 Monoclonal Antibody PE Conjugated, Flow Validated

FC00137-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD14 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD11b Monoclonal Antibody PE Conjugated, Flow Validated

FC00144-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD11b Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD19 Monoclonal Antibody PE Conjugated, Flow Validated

FC00154-PE 25 Tests, 100 Tests, 200 Tests
EUR 108
Description: Mouse Monoclonal human CD19 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

FC00171-PE 25 Tests, 100 Tests, 200 Tests
EUR 142
Description: Anti-Human CD54 Monoclonal Antibody PE Conjugated, Flow Validated

Anti-human CD38 Monoclonal Antibody PE Conjugated, Flow Validated

FC00193-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD38 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD25 Monoclonal Antibody PE Conjugated, Flow Validated

FC00214-PE 25 Tests, 100 Tests, 200 Tests
EUR 125
Description: Mouse Monoclonal human CD25 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD86 Monoclonal Antibody PE Conjugated, Flow Validated

FC00220-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Human CD86 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD4 Monoclonal Antibody PE Conjugated, Flow Validated

FC00344-PE 25 Tests, 100 Tests, 200 Tests
EUR 113
Description: Mouse Monoclonal human CD4 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-Human CD11c Monoclonal Antibody PE Conjugated, Flow Validated

FC00357-PE 25 Tests
EUR 136
Description: Mouse Monoclonal Human CD11c Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD5 Monoclonal Antibody PE Conjugated, Flow Validated

FC00480-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal Anti-human CD5 PE Conjugated, designed for Flow Cytometry and validated by Flow Cytometry using Human cells.

Anti-human CD45 Monoclonal Antibody PE Conjugated, Flow Validated

FC00555-PE 25 Tests, 100 Tests, 200 Tests
EUR 118
Description: Mouse Monoclonal human CD45 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD2 Monoclonal Antibody PE Conjugated, Flow Validated

FC00570-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD2 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD71 Monoclonal Antibody PE Conjugated, Flow Validated

FC00591-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD71 Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.

Anti-human CD62L Monoclonal Antibody PE Conjugated, Flow Validated

FC00652-PE 25 Tests, 100 Tests, 200 Tests
EUR 153
Description: Mouse Monoclonal human CD62L Antibody PE Conjugated, Flow Validated. Validated in Flow Cytometry and tested in Human.


PE-Cy5 (Phycoerhthrin-Cy5 Conjugate)

EUR 370

PE-Cy5 Tandem

2610 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Hamster IgG-Cy5 conjugate, isotype control (Syrian)

20003-1-Cy5 50 tests
EUR 225

Goat IgG F(ab')2 fragment-Cy5 conjugate

20011-FAB2-Cy5 50 tests
EUR 202

PE-Cy5 Calibration Kit

ECFP-F4-5K 5X1 mL
EUR 310
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

CD45RO Antibody (PE-Cy5)

abx134008-100Assays 100 Assays
EUR 495
  • Shipped within 5-10 working days.

CD45RO Antibody (PE-Cy5)

abx134008-50Assays 50 Assays
EUR 398
  • Shipped within 5-10 working days.

Annexin V-PE-Cy5 Reagent

EUR 1132

Annexin V-PE-Cy5 Reagent

EUR 403

Anti-Hu CD15 PE-Cy5

T8-138-T100 100 tests
EUR 240

Anti-Hu CD184 PE-Cy5

T8-146-T100 100 tests
EUR 240

Anti-Hu CD45 PE-Cy5

T8-160-T100 100 tests
EUR 240

Anti-Hu CD7 PE-Cy5

T8-183-T025 25 tests
EUR 140

Anti-Hu CD7 PE-Cy5

T8-183-T100 100 tests
EUR 240

Anti-Hu CD8 PE-Cy5

T8-207-T025 25 tests
EUR 140

Anti-Hu CD8 PE-Cy5

T8-207-T100 100 tests
EUR 240

Anti-Hu CD10 PE-Cy5

T8-209-T025 25 tests
EUR 140

Anti-Hu CD10 PE-Cy5

T8-209-T100 100 tests
EUR 240

Anti-Hu CD45 PE-Cy5

T8-222-T025 25 tests
EUR 140

Anti-Hu CD45 PE-Cy5

T8-222-T100 100 tests
EUR 240

Anti-Hu CD55 PE-Cy5

T8-230-T025 25 tests
EUR 140

Anti-Hu CD55 PE-Cy5

T8-230-T100 100 tests
EUR 240

Anti-Hu CD56 PE-Cy5

T8-231-T025 25 tests
EUR 140

Anti-Hu CD56 PE-Cy5

T8-231-T100 100 tests
EUR 240

Anti-Hu CD31 PE-Cy5

T8-273-T025 25 tests
EUR 140

Anti-Hu CD31 PE-Cy5

T8-273-T100 100 tests
EUR 240

Anti-Hu CD80 PE-Cy5

T8-287-T025 25 tests
EUR 140

Anti-Hu CD80 PE-Cy5

T8-287-T100 100 tests
EUR 240

Anti-Hu CD14 PE-Cy5

T8-293-T025 25 tests
EUR 140

Anti-Hu CD14 PE-Cy5

T8-293-T100 100 tests
EUR 240

Anti-Hu CD21 PE-Cy5

T8-306-T025 25 tests
EUR 140

Anti-Hu CD21 PE-Cy5

T8-306-T100 100 tests
EUR 240

Anti-Hu CD27 PE-Cy5

T8-308-T025 25 tests
EUR 140

Anti-Hu CD27 PE-Cy5

T8-308-T100 100 tests
EUR 240

Anti-Hu CD41 PE-Cy5

T8-309-T025 25 tests
EUR 140

Anti-Hu CD41 PE-Cy5

T8-309-T100 100 tests
EUR 240

Anti-Hu IgM PE-Cy5

T8-320-C025 0.025 mg
EUR 126

Anti-Hu IgM PE-Cy5

T8-320-C100 0.1 mg
EUR 213

Anti-Hu IgE PE-Cy5

T8-324-C025 0.025 mg
EUR 126

Anti-Hu IgE PE-Cy5

T8-324-C100 0.1 mg
EUR 213

Anti-Hu CD63 PE-Cy5

T8-343-T025 25 tests
EUR 140

Anti-Hu CD63 PE-Cy5

T8-343-T100 100 tests
EUR 240

Anti-Hu CD4 PE-Cy5

T8-359-T025 25 tests
EUR 140

Anti-Hu CD4 PE-Cy5

T8-359-T100 100 tests
EUR 240

Anti-Hu CD38 PE-Cy5

T8-366-T025 25 tests
EUR 140

Anti-Hu CD38 PE-Cy5

T8-366-T100 100 tests
EUR 240

Anti-Hu CD3 PE-Cy5

T8-514-T025 25 tests
EUR 140

Anti-Hu CD3 PE-Cy5

T8-514-T100 100 tests
EUR 240

Anti-Hu CD86 PE-Cy5

T8-531-T025 25 tests
EUR 140

Anti-Hu CD86 PE-Cy5

T8-531-T100 100 tests
EUR 240

Anti-Hu CD117 PE-Cy5

T8-586-T025 25 tests
EUR 140

Anti-Hu CD117 PE-Cy5

T8-586-T100 100 tests
EUR 240

Anti-Hu CD158d PE-Cy5

T8-609-T100 100 tests
EUR 240

Anti-Hu CD20 PE-Cy5

T8-638-T025 25 tests
EUR 140

Anti-Hu CD20 PE-Cy5

T8-638-T100 100 tests
EUR 240


Product not found


HDM Inhibitor, 2,4-PDCA

EUR 229

Rat Anti-Mouse CD317 (BST2, PDCA-1) Monoclonal antibody, clone 927

CABT-L4537-1mg 1 mg
EUR 897

Rat Anti-Mouse CD317 (BST2, PDCA-1) Monoclonal antibody, clone 927

CABT-L4537-5mg 5 mg
EUR 2405

Neuregulin/Heregulin-1? (NRG-1?/HRG-1?), human recombinant protein

P1054-1 1 mg
EUR 3947
Description: Neuregulin (NRG) is a signaling protein for ErbB2/ErbB4 receptor heterodimers on the cardiac muscle cells and plays an important role in heart structure and function through inducing cardiomyocyte differentiation

Angiotensin 1/2 (1-7) amide

A1054-1 1 mg
EUR 96
Description: Angiotensin I/II (1-7) amide (H2N-Asp-Arg-Val-Tyr-Ile-His-Pro-amide) is a peptide analog to angiotensin II that is used as a vasopressor in the treatment of certain types of shock and circulatory collapse.

Angiotensin 1/2 (1-8) amide

A1055-1 1 mg
EUR 96
Description: The physiologically active peptide angiotensin-2 (angiotensin 1- 8) is yielded from angiotensin-1, a substrate of ACE (angiotensin converting enzyme), by removing a dipeptide.

Endothelin-1 (1-15), amide, human

A1111-1 1 mg
EUR 722
Description: Endothelins are 21-amino acid vasoconstricting peptides produced primarily in the endothelium and have a key role in vascular homeostasis.

Haptoglobin, (Phenotype 1-1) Human Plasma

EUR 321

UK 1

C5006-1 1 mg
EUR 363
Description: UK 1, an unusual bis-benzoxazole metabolite isolated from Streptomyces sp. 517-02, is an inhibitor of topoisomerase II (Topo II) and hepatitis C viral replication.


C5053-1 1 mg
EUR 132
Description: IC50: 30-60 nM for thyroid cancer cells KP372-1 is a specific Akt inhibitor. The phosphatidylinositol 3' kinase (PI3K)/phosphatase, which is a key regulator of cell proliferation and survival, is mutated or activated in various cancers.


EUR 142


B5722-.1 100 ug
EUR 583
Description: ADWX 1 is a potent and selective inhibitor of KV1.3 channel with IC50 values of 1.89 pM and 0.65 nM for Kv1.3 and Kv1.1, respectively [1].

Purotoxin 1

B5771-.1 100 µg
EUR 380

Shz 1

B5772-1 1 mg
EUR 118

Psalmotoxin 1

B5796-.1 100 ug
EUR 447
Description: IC50: 0.9 nMPsalmotoxin 1 is a potent and selective acid-sensing ion channel 1a (ASIC1a) blocker.Several ASIC subunits described: ASIC1a, ASIC1b, ASIC2a, ASIC2b, and ASIC3 with different kinetics, tissue distribution, and external pH sensitivities.


B4686-1 1 mg
EUR 268
Description: TAPI-1 is an inhibitor of tumour necrosis factor with IC50 value of 8.09 ?M [1].TAPI-1 is an inhibitor of TACE/ADAM17 which catalyzes the cleavage of full-length APP to the soluble N-terminal fragment (sAPP?).


B5240-1 1 mg
EUR 399


B5427-1 1 mg
EUR 268


B5446-1 1 mg
EUR 268


B5452-.1 100 ug
EUR 415

Flutax 1

B6986-1 1 mg
EUR 399


B7566-1 1 mg
EUR 118


B7823-1 1 mg
EUR 154
Description: Rbin-1 is an eukaryotic ribosome assembly inhibitor.All cellular proteins are synthesized by ribosomes, whose biogenesis is a complex multi-step process quickly completed in eukaryotes.


EUR 204


EUR 137


EUR 289

StemRegenin 1

EUR 147


EUR 126


EUR 147


EUR 115


EUR 398


B2991-1 1mg
EUR 125

IL-1-beta Interleukin-1 betaHuman Recombinant Protein

PROTP01584-1 Regular: 10ug
EUR 317
Description: Interleukin-1 beta Human Recombinant produced in E.Coli is a non-glycosylated, Polypeptide chain containing 153 amino acids and having a molecular mass of 17000 Dalton.;The IL-1b is purified by proprietary chromatographic techniques.

MMP-1 Matrix Metalloproteinase-1 Human Recombinant Protein

PROTP03956-1 Regular: 20ug
EUR 317
Description: MMP 1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 393 amino acids (100-469a.a) and having a molecular mass of 45kDa. MMP 1 is fused to a 23 amino acid His-tag at N-terminus.

Anti-HO-1 Monoclonal Antibody (HO-1-2)

M00253-1 1mg
EUR 397
Description: Mouse Monoclonal HO-1 Antibody (HO-1-2). Validated in Flow Cytometry, IHC, WB and tested in Human, Mouse, Rat.

RN-1 (hydrochloride)

C4247-1 1 mg
EUR 112
Description: RN-1 (hydrochloride) is a brain-penetrant, potent and irreversible LSD1 inhibitor with IC50 values of 10-70 nM [1]. Lysine-specific demethylase 1 (LSD1) is a flavin-dependent monoamine oxidase that demethylate mono- and di-methylated lysines, specifically histone 3, lysines 4 and 9.

Teicoplanin A3-1

C4943-1 1 mg
EUR 326
Description: Teicoplanin A3-1, also known as Antibiotic L 17054, is a glycopeptide antibiotic derived from Actinoplanes teichomyceticus and produces a potent broad spectrum antibiotic activity against gram-positive bacteria.

TASIN-1 hydrochloride

EUR 142


EUR 142

PACAP 1-38

B6625-1 1 mg
EUR 347


B6707-1 1 mg
EUR 181
Description: Sphingosine-1-phosphate is an endogenous second messenger that involved in cell proliferation and survival and is a ligand for S1PR1 [1] [2].

HPGDS inhibitor 1

B1046-1 1 mg
EUR 181
Description: HPGDS inhibitor 1 is an oral potent and selective inhibitor of hematopoietic prostaglandin D synthase (HPGDS) with IC50 value of 0.7nM [1].Prostaglandin D2 (PGD2) is a mediator of allergy and inflammation.


EUR 185


B4665-1 1 mg
EUR 358

LPA2 antagonist 1

B4726-1 1 mg
EUR 319

PACAP 1-27

B5075-1 1 mg
EUR 290

Nociceptin (1-7)

B5087-1 1 mg
EUR 399

Hemokinin 1 (mouse)

B5127-1 1 mg
EUR 321

GIP (1-39)

B5280-1 1 mg
EUR 609

JMV 390-1

B5317-1 1 mg
EUR 242

Hemokinin 1 (human)

B5318-1 1 mg
EUR 340

Echistatin, ?1 isoform

B5391-.1 100 ug
EUR 583

SL 0101-1

B9008-1 1 mg
EUR 163

StemRegenin 1 (hydrochloride)

C3551-1 1 mg
EUR 118
Description: IC50: 127 nM in CD34+ cellsStemRegenin 1 is an aryl hydrocarbon receptor signaling antagonist.The aryl hydrocarbon receptor (AhR ) is a protein that is encoded by the AHR gene.


C3211-1 1 mg
EUR 139
Description: IC50: 59 nMIDO-IN-1 is an indoleamine-2,3-dioxygenase (IDO) inhibitor.


PECAM- 1 Antibody

ABF0077 100 ug
EUR 438


GT15190 100 ug
EUR 526

PECAM-1/CD31/ Rat PECAM- 1/ CD31 ELISA Kit

ELA-E0363r 96 Tests
EUR 886

CD31/PECAM-1 Antibody

48124-100ul 100ul