BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

GALNT5

GALNT5 siRNA

20-abx902083
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT5 siRNA

20-abx917542
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT5 siRNA

20-abx917543
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT5 antibody

70R-7239 50 ug
EUR 467
Description: Rabbit polyclonal GALNT5 antibody

GALNT5 Blocking Peptide

33R-2573 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT5 antibody, catalog no. 70R-7239

pCMV-SPORT6-GALNT5

PVT14678 2 ug
EUR 495

Rat GALNT5 shRNA Plasmid

20-abx986824
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GALNT5 ELISA KIT

ELI-43218h 96 Tests
EUR 824

Mouse Galnt5 ELISA KIT

ELI-47383m 96 Tests
EUR 865

Human GALNT5 shRNA Plasmid

20-abx957694
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GALNT5 shRNA Plasmid

20-abx982514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal GALNT5 Antibody (N-term)

APR16072G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GALNT5 (N-term). This antibody is tested and proven to work in the following applications:

Galnt5 ORF Vector (Rat) (pORF)

ORF067394 1.0 ug DNA
EUR 506

Galnt5 ORF Vector (Mouse) (pORF)

ORF045281 1.0 ug DNA
EUR 506

GALNT5 ORF Vector (Human) (pORF)

ORF019986 1.0 ug DNA
EUR 405

Polypeptide N-Acetylgalactosaminyltransferase 5 (GALNT5) Antibody

abx034600-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 5 (GALNT5) Antibody

abx034600-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GALNT5 sgRNA CRISPR Lentivector set (Human)

K0835501 3 x 1.0 ug
EUR 339

Galnt5 sgRNA CRISPR Lentivector set (Mouse)

K3892101 3 x 1.0 ug
EUR 339

Galnt5 sgRNA CRISPR Lentivector set (Rat)

K6977201 3 x 1.0 ug
EUR 339

GALNT5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0835502 1.0 ug DNA
EUR 154

GALNT5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0835503 1.0 ug DNA
EUR 154

GALNT5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0835504 1.0 ug DNA
EUR 154

Galnt5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3892102 1.0 ug DNA
EUR 154

Galnt5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3892103 1.0 ug DNA
EUR 154

Galnt5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3892104 1.0 ug DNA
EUR 154

Galnt5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6977202 1.0 ug DNA
EUR 154

Galnt5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6977203 1.0 ug DNA
EUR 154

Galnt5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6977204 1.0 ug DNA
EUR 154

GALNT5 Protein Vector (Human) (pPB-C-His)

PV079941 500 ng
EUR 811

GALNT5 Protein Vector (Human) (pPB-N-His)

PV079942 500 ng
EUR 811

GALNT5 Protein Vector (Human) (pPM-C-HA)

PV079943 500 ng
EUR 811

GALNT5 Protein Vector (Human) (pPM-C-His)

PV079944 500 ng
EUR 811

GALNT5 Protein Vector (Rat) (pPB-C-His)

PV269574 500 ng
EUR 1166

GALNT5 Protein Vector (Rat) (pPB-N-His)

PV269575 500 ng
EUR 1166

GALNT5 Protein Vector (Rat) (pPM-C-HA)

PV269576 500 ng
EUR 1166

GALNT5 Protein Vector (Rat) (pPM-C-His)

PV269577 500 ng
EUR 1166

GALNT5 Protein Vector (Mouse) (pPB-C-His)

PV181122 500 ng
EUR 1065

GALNT5 Protein Vector (Mouse) (pPB-N-His)

PV181123 500 ng
EUR 1065

GALNT5 Protein Vector (Mouse) (pPM-C-HA)

PV181124 500 ng
EUR 1065

GALNT5 Protein Vector (Mouse) (pPM-C-His)

PV181125 500 ng
EUR 1065

Galnt5 3'UTR Luciferase Stable Cell Line

TU204931 1.0 ml Ask for price

Galnt5 3'UTR GFP Stable Cell Line

TU156888 1.0 ml Ask for price

GALNT5 3'UTR Luciferase Stable Cell Line

TU008524 1.0 ml
EUR 1521

Galnt5 3'UTR Luciferase Stable Cell Line

TU106888 1.0 ml Ask for price

GALNT5 3'UTR GFP Stable Cell Line

TU058524 1.0 ml
EUR 1521

Galnt5 3'UTR GFP Stable Cell Line

TU254931 1.0 ml Ask for price

GALNT5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV660889 1.0 ug DNA
EUR 1355

GALNT5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV660893 1.0 ug DNA
EUR 1355

GALNT5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV660894 1.0 ug DNA
EUR 1355

GALNT5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0835505 3 x 1.0 ug
EUR 376

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3892105 3 x 1.0 ug
EUR 376

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6977205 3 x 1.0 ug
EUR 376

GALNT5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0835506 1.0 ug DNA
EUR 167

GALNT5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0835507 1.0 ug DNA
EUR 167

GALNT5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0835508 1.0 ug DNA
EUR 167

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3892106 1.0 ug DNA
EUR 167

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3892107 1.0 ug DNA
EUR 167

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3892108 1.0 ug DNA
EUR 167

GALNT5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV660890 1.0 ug DNA
EUR 1355

GALNT5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV660891 1.0 ug DNA
EUR 1413

GALNT5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV660892 1.0 ug DNA
EUR 1413

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6977206 1.0 ug DNA
EUR 167

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6977207 1.0 ug DNA
EUR 167

Galnt5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6977208 1.0 ug DNA
EUR 167

GOLGB1

GOLGB1 antibody

70R-6855 50 ug
EUR 467
Description: Rabbit polyclonal GOLGB1 antibody raised against the N terminal of GOLGB1

GOLGB1 antibody

10R-1470 100 ug
EUR 512
Description: Mouse monoclonal GOLGB1 antibody

GOLGB1 Antibody

1-CSB-PA622788LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GOLGB1. Recognizes GOLGB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

GOLGB1 Blocking Peptide

33R-6750 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GOLGB1 antibody, catalog no. 70R-6855

Human GOLGB1 shRNA Plasmid

20-abx951874
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GOLGB1 Antibody, HRP conjugated

1-CSB-PA622788LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GOLGB1. Recognizes GOLGB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GOLGB1 Antibody, FITC conjugated

1-CSB-PA622788LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GOLGB1. Recognizes GOLGB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GOLGB1 Antibody, Biotin conjugated

1-CSB-PA622788LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GOLGB1. Recognizes GOLGB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Giantin (GOLGB1) ELISA Kit

abx259595-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Golgb1 ORF Vector (Rat) (pORF)

ORF067702 1.0 ug DNA
EUR 3447

Golgb1 ORF Vector (Mouse) (pORF)

ORF046379 1.0 ug DNA
EUR 3501

GOLGB1 ORF Vector (Human) (pORF)

ORF020305 1.0 ug DNA
EUR 405

GOLGB1 sgRNA CRISPR Lentivector set (Human)

K0882701 3 x 1.0 ug
EUR 339

Human Golgin B1 (GOLGB1)ELISA Kit

201-12-2733 96 tests
EUR 440
  • This Golgin B1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Golgb1 sgRNA CRISPR Lentivector set (Mouse)

K4846101 3 x 1.0 ug
EUR 339

Golgb1 sgRNA CRISPR Lentivector set (Rat)

K7532201 3 x 1.0 ug
EUR 339

Human Golgin B1(GOLGB1)ELISA Kit

QY-E03370 96T
EUR 361

GOLGB1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0882702 1.0 ug DNA
EUR 154

GOLGB1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0882703 1.0 ug DNA
EUR 154

GOLGB1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0882704 1.0 ug DNA
EUR 154

Golgb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4846102 1.0 ug DNA
EUR 154

Golgb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4846103 1.0 ug DNA
EUR 154

Golgb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4846104 1.0 ug DNA
EUR 154

Golgb1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7532202 1.0 ug DNA
EUR 154

Golgb1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7532203 1.0 ug DNA
EUR 154

Golgb1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7532204 1.0 ug DNA
EUR 154

GOLGB1 Protein Vector (Human) (pPB-C-His)

PV081217 500 ng
EUR 5013

GOLGB1 Protein Vector (Human) (pPB-N-His)

PV081218 500 ng
EUR 5013

GOLGB1 Protein Vector (Human) (pPM-C-HA)

PV081219 500 ng
EUR 5013

GOLGB1 Protein Vector (Human) (pPM-C-His)

PV081220 500 ng
EUR 5013

GOLGB1 Protein Vector (Mouse) (pPB-C-His)

PV185514 500 ng
EUR 5184

GOLGB1 Protein Vector (Mouse) (pPB-N-His)

PV185515 500 ng
EUR 5184

GOLGB1 Protein Vector (Mouse) (pPM-C-HA)

PV185516 500 ng
EUR 5184

GOLGB1 Protein Vector (Mouse) (pPM-C-His)

PV185517 500 ng
EUR 5184

GOLGB1 Protein Vector (Rat) (pPB-C-His)

PV270806 500 ng
EUR 5106

GOLGB1 Protein Vector (Rat) (pPB-N-His)

PV270807 500 ng
EUR 5106

GOLGB1 Protein Vector (Rat) (pPM-C-HA)

PV270808 500 ng
EUR 5106

GOLGB1 Protein Vector (Rat) (pPM-C-His)

PV270809 500 ng
EUR 5106

Golgb1 3'UTR Luciferase Stable Cell Line

TU205257 1.0 ml Ask for price

Golgb1 3'UTR GFP Stable Cell Line

TU158898 1.0 ml Ask for price

GOLGB1 3'UTR Luciferase Stable Cell Line

TU009071 1.0 ml
EUR 4617

Golgb1 3'UTR Luciferase Stable Cell Line

TU108898 1.0 ml Ask for price

GOLGB1 3'UTR GFP Stable Cell Line

TU059071 1.0 ml
EUR 4617

Golgb1 3'UTR GFP Stable Cell Line

TU255257 1.0 ml Ask for price

GOLGB1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV663361 1.0 ug DNA
EUR 4719

GOLGB1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV663365 1.0 ug DNA
EUR 4719

GOLGB1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV663366 1.0 ug DNA
EUR 4719

Human Golgin subfamily B member 1, GOLGB1 ELISA KIT

ELI-09744h 96 Tests
EUR 824

GOLGB1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0882705 3 x 1.0 ug
EUR 376

Golgb1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4846105 3 x 1.0 ug
EUR 376

Golgb1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7532205 3 x 1.0 ug
EUR 376

GOLGB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0882706 1.0 ug DNA
EUR 167

GOLGB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0882707 1.0 ug DNA
EUR 167

GOLGB1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0882708 1.0 ug DNA
EUR 167

Golgb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4846106 1.0 ug DNA
EUR 167

Golgb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4846107 1.0 ug DNA
EUR 167

Golgb1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4846108 1.0 ug DNA
EUR 167

GOLGB1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV663362 1.0 ug DNA
EUR 4719

GOLGB1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV663363 1.0 ug DNA
EUR 4777

GOLGB1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV663364 1.0 ug DNA
EUR 4777

CSNK2B

CSNK2B siRNA

20-abx901300
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CSNK2B siRNA

20-abx912969
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CSNK2B siRNA

20-abx912970
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CSNK2B antibody

70R-21497 50 ul
EUR 435
Description: Rabbit polyclonal CSNK2B antibody

CSNK2B Antibody

49753-100ul 100ul
EUR 333

CSNK2B Antibody

49753-50ul 50ul
EUR 239

CSNK2B Antibody

31171-100ul 100ul
EUR 252

CSNK2B Antibody

31171-50ul 50ul
EUR 187

CSNK2B Antibody

1-CSB-PA001220
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CSNK2B. Recognizes CSNK2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

CSNK2B Antibody

1-CSB-PA006075GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CSNK2B. Recognizes CSNK2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CSNK2B Antibody

1-CSB-PA099774
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CSNK2B. Recognizes CSNK2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CSNK2B Antibody

1-CSB-PA01655A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSNK2B. Recognizes CSNK2B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CSNK2B Conjugated Antibody

C49753 100ul
EUR 397

CSNK2B Conjugated Antibody

C31171 100ul
EUR 397

CSNK2B Polyclonal Antibody

A51553 100 µg
EUR 570.55
Description: Ask the seller for details

CSNK2B Rabbit pAb

A14722-100ul 100 ul
EUR 308

CSNK2B Rabbit pAb

A14722-200ul 200 ul
EUR 459

CSNK2B Rabbit pAb

A14722-20ul 20 ul
EUR 183

CSNK2B Rabbit pAb

A14722-50ul 50 ul
EUR 223

CSNK2B Rabbit pAb

A2869-100ul 100 ul
EUR 308

CSNK2B Rabbit pAb

A2869-200ul 200 ul
EUR 459

CSNK2B Rabbit pAb

A2869-20ul 20 ul
EUR 183

CSNK2B Rabbit pAb

A2869-50ul 50 ul
EUR 223

pExpress-Csnk2b-r

PVT17510 2 ug
EUR 231

Anti-CSNK2B antibody

STJ73447 100 µg
EUR 359

Anti-CSNK2B antibody

STJ23246 100 µl
EUR 277
Description: This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene.

Anti-CSNK2B antibody

STJ116922 100 µl
EUR 277
Description: This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene.

Rat CSNK2B shRNA Plasmid

20-abx986624
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CSNK2B ELISA Kit

ELA-E1679h 96 Tests
EUR 824

CSNK2B ELISA KIT|Human

EF006001 96 Tests
EUR 689

Human CSNK2B shRNA Plasmid

20-abx951030
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CSNK2B shRNA Plasmid

20-abx969858
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-CSNK2B (S209) Antibody

1-CSB-PA007369
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CSNK2B (S209). Recognizes Phospho-CSNK2B (S209) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

CSNK2B Antibody, HRP conjugated

1-CSB-PA01655B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSNK2B. Recognizes CSNK2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CSNK2B Antibody, FITC conjugated

1-CSB-PA01655C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSNK2B. Recognizes CSNK2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CSNK2B Antibody, Biotin conjugated

1-CSB-PA01655D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CSNK2B. Recognizes CSNK2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CSNK2B Recombinant Protein (Human)

RP053260 100 ug Ask for price

CSNK2B Recombinant Protein (Rat)

RP196535 100 ug Ask for price

CSNK2B Recombinant Protein (Rat)

RP196538 100 ug Ask for price

CSNK2B Recombinant Protein (Mouse)

RP126338 100 ug Ask for price

Monoclonal CSNK2B Antibody, Clone: 2F12F3

APG02816G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CSNK2B. The antibodies are raised in Mouse and are from clone 2F12F3. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal CSNK2B Antibody, Clone: 1H8A5

AMM03010G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CSNK2B. The antibodies are raised in Mouse and are from clone 1H8A5. This antibody is applicable in WB, FC, E

CSNK2B Polyclonal Antibody, HRP Conjugated

A51554 100 µg
EUR 570.55
Description: The best epigenetics products

CSNK2B Polyclonal Antibody, FITC Conjugated

A51555 100 µg
EUR 570.55
Description: kits suitable for this type of research

CSNK2B Polyclonal Antibody, Biotin Conjugated

A51556 100 µg
EUR 570.55
Description: fast delivery possible

Csnk2b ORF Vector (Rat) (pORF)

ORF065513 1.0 ug DNA
EUR 506

Csnk2b ORF Vector (Rat) (pORF)

ORF065514 1.0 ug DNA
EUR 506

Csnk2b ORF Vector (Mouse) (pORF)

ORF042114 1.0 ug DNA
EUR 506

CSNK2B ORF Vector (Human) (pORF)

ORF017754 1.0 ug DNA
EUR 405

Anti-CSNK2B (aa172-186) antibody

STJ73446 100 µg
EUR 359

CSNK2B ELISA Kit (Human) (OKEH01211)

OKEH01211 96 Wells
EUR 662
Description: Description of target: This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 33 pg/mL

CSNK2B ELISA Kit (Mouse) (OKEH05370)

OKEH05370 96 Wells
EUR 662
Description: Description of target: Plays a complex role in regulating the basal catalytic activity of the alpha subunit. Participates in Wnt signaling.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.79 pg/mL

CSNK2B ELISA Kit (Rat) (OKEH06122)

OKEH06122 96 Wells
EUR 662
Description: Description of target: Participates in Wnt signaling. Plays a complex role in regulating the basal catalytic activity of the alpha subunit.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.8 pg/mL

Polyclonal Csnk2b Antibody - N-terminal region

APR01029G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Csnk2b - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal CSNK2B Antibody (C-term F168)

APR05841G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CSNK2B (C-term F168). This antibody is tested and proven to work in the following applications:

CSNK2B sgRNA CRISPR Lentivector set (Human)

K0518101 3 x 1.0 ug
EUR 339

Casein Kinase 2 Beta (CSNK2B) Antibody

20-abx111418
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Casein Kinase 2 Beta (CSNK2B) Antibody

20-abx109604
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Casein Kinase 2 Beta (CSNK2B) Antibody

20-abx328940
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Casein Kinase 2 Beta (CSNK2B) Antibody

20-abx214618
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Csnk2b sgRNA CRISPR Lentivector set (Mouse)

K3411501 3 x 1.0 ug
EUR 339

Csnk2b sgRNA CRISPR Lentivector set (Rat)

K7062901 3 x 1.0 ug
EUR 339

Polyclonal Goat Anti-CSNK2B Antibody (internal region)

APG00983G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CSNK2B (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-CSNK2B Antibody (internal region)

APG00984G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CSNK2B (internal region). This antibody is tested and proven to work in the following applications:

CSNK2B sgRNA CRISPR Lentivector (Human) (Target 1)

K0518102 1.0 ug DNA
EUR 154

CSNK2B sgRNA CRISPR Lentivector (Human) (Target 2)

K0518103 1.0 ug DNA
EUR 154

CSNK2B sgRNA CRISPR Lentivector (Human) (Target 3)

K0518104 1.0 ug DNA
EUR 154

Casein Kinase 2 Beta (CSNK2B) Antibody (Biotin)

20-abx105218
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Casein Kinase 2 Beta (CSNK2B) Antibody (FITC)

20-abx106635
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Casein Kinase 2 Beta (CSNK2B) Antibody (HRP)

20-abx108052
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DPAGT1

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

DLR-DPAGT1-Hu-96T 96T
EUR 673
  • Should the Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RDR-DPAGT1-Hu-48Tests 48 Tests
EUR 544

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RDR-DPAGT1-Hu-96Tests 96 Tests
EUR 756

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RD-DPAGT1-Hu-48Tests 48 Tests
EUR 521

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

RD-DPAGT1-Hu-96Tests 96 Tests
EUR 723

DPAGT1 siRNA

20-abx914521
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DPAGT1 siRNA

20-abx914522
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DPAGT1 Antibody

25355-100ul 100ul
EUR 390

pOTB7-DPAGT1

PVT18256 2 ug
EUR 231

DPAGT1 cloning plasmid

CSB-CL884460HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgtgggccttctcggaattgcccatgccgctgctgatcaatttgatcgtctcgctgctgggatttgtggccacagtcaccctcatcccggccttccggggccacttcattgctgcgcgcctctgtggtcaggacctcaacaaaaccagccgacagcagatcccagaatcccagg
  • Show more
Description: A cloning plasmid for the DPAGT1 gene.

pCMV-SPORT6-DPAGT1

PVT19083 2 ug
EUR 231

Anti-DPAGT1 (1G1)

YF-MA12723 100 ug
EUR 363
Description: Mouse monoclonal to DPAGT1

Human DPAGT1 shRNA Plasmid

20-abx951251
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DPAGT1 shRNA Plasmid

20-abx970044
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPAGT1 Recombinant Protein (Human)

RP009724 100 ug Ask for price

DPAGT1 Recombinant Protein (Rat)

RP198542 100 ug Ask for price

DPAGT1 Recombinant Protein (Mouse)

RP129881 100 ug Ask for price

DPAGT1 ORF Vector (Human) (pORF)

ORF003242 1.0 ug DNA
EUR 95

Dpagt1 ORF Vector (Rat) (pORF)

ORF066182 1.0 ug DNA
EUR 506

Dpagt1 ORF Vector (Mouse) (pORF)

ORF043295 1.0 ug DNA
EUR 506

DPAGT1 ELISA Kit (Human) (OKCD09162)

OKCD09162 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic reticulum. The congenital disorder of glycosylation type Ij is caused by mutation in the gene encoding this enzyme.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

DPAGT1 ELISA Kit (Human) (OKDD00239)

OKDD00239 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic reticulum. The congenital disorder of glycosylation type Ij is caused by mutation in the gene encoding this enzyme.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

DPAGT1 sgRNA CRISPR Lentivector set (Human)

K0626301 3 x 1.0 ug
EUR 339

Dpagt1 sgRNA CRISPR Lentivector set (Mouse)

K4848801 3 x 1.0 ug
EUR 339

Dpagt1 sgRNA CRISPR Lentivector set (Rat)

K6619601 3 x 1.0 ug
EUR 339

DPAGT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0626302 1.0 ug DNA
EUR 154

DPAGT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0626303 1.0 ug DNA
EUR 154

DPAGT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0626304 1.0 ug DNA
EUR 154

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx034594-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx034594-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx027715-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

abx027715-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

20-abx172147
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Antibody

20-abx176193
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dpagt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4848802 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4848803 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4848804 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6619602 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6619603 1.0 ug DNA
EUR 154

Dpagt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6619604 1.0 ug DNA
EUR 154

DPAGT1 Protein Vector (Mouse) (pPB-C-His)

PV173178 500 ng
EUR 603

DPAGT1 Protein Vector (Mouse) (pPB-N-His)

PV173179 500 ng
EUR 603

DPAGT1 Protein Vector (Mouse) (pPM-C-HA)

PV173180 500 ng
EUR 603

DPAGT1 Protein Vector (Mouse) (pPM-C-His)

PV173181 500 ng
EUR 603

DPAGT1 Protein Vector (Human) (pPB-C-His)

PV012965 500 ng
EUR 329

DPAGT1 Protein Vector (Human) (pPB-N-His)

PV012966 500 ng
EUR 329

DPAGT1 Protein Vector (Human) (pPM-C-HA)

PV012967 500 ng
EUR 329

DPAGT1 Protein Vector (Human) (pPM-C-His)

PV012968 500 ng
EUR 329

DPAGT1 Protein Vector (Rat) (pPB-C-His)

PV264726 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPB-N-His)

PV264727 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPM-C-HA)

PV264728 500 ng
EUR 603

DPAGT1 Protein Vector (Rat) (pPM-C-His)

PV264729 500 ng
EUR 603

Dpagt1 3'UTR Luciferase Stable Cell Line

TU203592 1.0 ml Ask for price

Dpagt1 3'UTR GFP Stable Cell Line

TU155343 1.0 ml Ask for price

DPAGT1 3'UTR Luciferase Stable Cell Line

TU006258 1.0 ml
EUR 2333

Dpagt1 3'UTR Luciferase Stable Cell Line

TU105343 1.0 ml Ask for price

DPAGT1 3'UTR GFP Stable Cell Line

TU056258 1.0 ml
EUR 2333

Dpagt1 3'UTR GFP Stable Cell Line

TU253592 1.0 ml Ask for price

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) Protein

20-abx653204
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

DPAGT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621085 1.0 ug DNA
EUR 682

DPAGT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621089 1.0 ug DNA
EUR 682

DPAGT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621090 1.0 ug DNA
EUR 682

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

20-abx151343
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) CLIA Kit

20-abx495644
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

SEJ239Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • In
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in Tissue homogenates, cell lysates and other biological fluids.

Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) ELISA Kit

4-SEJ239Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 elisa. Alternative names of the recognized antigen: ALG7
  • CDG-Ij
  • DGPT
  • DPAGT
  • DPAGT2
  • G1PT
  • GPT
  • UAGT
  • UGAT
  • GlcNAc-1-P Transferase
  • UDP-N-acetylglucosamine--dolichyl-phosphate
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human DPAGT1 (Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1)

ELK4380 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 (DPAGT1). Standards or samples are then added to the appropriate microtiter plate wells with a bioti
  • Show more
Description: A sandwich ELISA kit for detection of Dolichyl Phosphate-N-Acetylglucosaminephosphotransferase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

DYNLL1

DYNLL1 siRNA

20-abx901615
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNLL1 siRNA

20-abx914811
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNLL1 siRNA

20-abx914812
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNLL1 antibody

70R-2573 50 ug
EUR 467
Description: Rabbit polyclonal DYNLL1 antibody raised against the N terminal of DYNLL1

DYNLL1 antibody

70R-2617 50 ug
EUR 467
Description: Rabbit polyclonal DYNLL1 antibody raised against the middle region of DYNLL1

DYNLL1 Antibody

ABD2630 100 ug
EUR 438

DYNLL1 Antibody

49177-100ul 100ul
EUR 333

DYNLL1 Antibody

49177-50ul 50ul
EUR 239

DYNLL1 Antibody

33008-100ul 100ul
EUR 252

DYNLL1 Antibody

DF2630 200ul
EUR 304
Description: DYNLL1 antibody detects endogenous levels of total DYNLL1.

DYNLL1 Antibody

1-CSB-PA01284A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

DYNLL1 Antibody

1-CSB-PA244606
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DYNLL1 Antibody

1-CSB-PA078374
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

DYNLL1 Conjugated Antibody

C49177 100ul
EUR 397

DYNLL1 Conjugated Antibody

C33008 100ul
EUR 397

DYNLL1 cloning plasmid

CSB-CL007299HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 270
  • Sequence: ATGTGCGACCGAAAGGCCGTGATCAAAAATGCGGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTACTCAGGCGCTGGAGAAATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTTGACAAGAAGTACAATCCCACCTGGCATTGCATCGTGGG
  • Show more
Description: A cloning plasmid for the DYNLL1 gene.

DYNLL1 Rabbit pAb

A5742-100ul 100 ul
EUR 308

DYNLL1 Rabbit pAb

A5742-200ul 200 ul
EUR 459

DYNLL1 Rabbit pAb

A5742-20ul 20 ul
EUR 183

DYNLL1 Rabbit pAb

A5742-50ul 50 ul
EUR 223

DYNLL1 Polyclonal Antibody

A53885 100 µg
EUR 570.55
Description: Ask the seller for details

DYNLL1 Rabbit mAb

A4353-100ul 100 ul
EUR 410

DYNLL1 Rabbit mAb

A4353-200ul 200 ul
EUR 571

DYNLL1 Rabbit mAb

A4353-20ul 20 ul
EUR 221

DYNLL1 Rabbit mAb

A4353-50ul 50 ul
EUR 287

DYNLL1 Rabbit pAb

A14496-100ul 100 ul
EUR 308

DYNLL1 Rabbit pAb

A14496-200ul 200 ul
EUR 459

DYNLL1 Rabbit pAb

A14496-20ul 20 ul
EUR 183

DYNLL1 Rabbit pAb

A14496-50ul 50 ul
EUR 223

DYNLL1 Blocking Peptide

33R-5809 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNLL1 antibody, catalog no. 70R-2573

DYNLL1 Blocking Peptide

33R-2498 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNLL1 antibody, catalog no. 70R-2617

DYNLL1 Blocking Peptide

DF2630-BP 1mg
EUR 195

Anti-DYNLL1 antibody

STJ28309 100 µl
EUR 277
Description: Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized.

Anti-DYNLL1 antibody

STJ116707 100 µl
EUR 277
Description: Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized.

Mouse DYNLL1 shRNA Plasmid

20-abx974785
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DYNLL1 shRNA Plasmid

20-abx985931
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DYNLL1 shRNA Plasmid

20-abx955692
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DYNLL1 protein (His tag)

80R-1506 100 ug
EUR 305
Description: Purified recombinant Human DYNLL1 protein

DYNLL1 recombinant monoclonal antibody

A5640 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human DYNLL1 for WB ,ELISA

DYNLL1 Antibody, HRP conjugated

1-CSB-PA01284B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYNLL1 Antibody, FITC conjugated

1-CSB-PA01284C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYNLL1 Antibody, Biotin conjugated

1-CSB-PA01284D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNLL1. Recognizes DYNLL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYNLL1 Recombinant Protein (Human)

RP038683 100 ug Ask for price

DYNLL1 Recombinant Protein (Rat)

RP198890 100 ug Ask for price

DYNLL1 Recombinant Protein (Mouse)

RP130424 100 ug Ask for price

DYNLL1 Polyclonal Antibody, HRP Conjugated

A53886 100 µg
EUR 570.55
Description: The best epigenetics products

DYNLL1 Polyclonal Antibody, FITC Conjugated

A53887 100 µg
EUR 570.55
Description: kits suitable for this type of research

DYNLL1 Polyclonal Antibody, Biotin Conjugated

A53888 100 µg
EUR 570.55
Description: fast delivery possible

Dynll1 ORF Vector (Rat) (pORF)

ORF066298 1.0 ug DNA
EUR 506

Dynll1 ORF Vector (Mouse) (pORF)

ORF043476 1.0 ug DNA
EUR 506

DYNLL1 ORF Vector (Human) (pORF)

ORF012895 1.0 ug DNA
EUR 354

DYNLL1 sgRNA CRISPR Lentivector set (Human)

K0643801 3 x 1.0 ug
EUR 339

Dynll1 sgRNA CRISPR Lentivector set (Mouse)

K3781001 3 x 1.0 ug
EUR 339

Dynll1 sgRNA CRISPR Lentivector set (Rat)

K6845101 3 x 1.0 ug
EUR 339

Anti-DYNLL1/Pin Rabbit Monoclonal Antibody

M03454 100ug/vial
EUR 397
Description: Rabbit Monoclonal DYNLL1/Pin Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

DYNLL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0643802 1.0 ug DNA
EUR 154

DYNLL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0643803 1.0 ug DNA
EUR 154

DYNLL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0643804 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3781002 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3781003 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3781004 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6845102 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6845103 1.0 ug DNA
EUR 154

Dynll1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6845104 1.0 ug DNA
EUR 154

DYNLL1 Protein Vector (Human) (pPB-C-His)

PV051577 500 ng
EUR 481

DYNLL1 Protein Vector (Human) (pPB-N-His)

PV051578 500 ng
EUR 481

DYNLL1 Protein Vector (Human) (pPM-C-HA)

PV051579 500 ng
EUR 481

DYNLL1 Protein Vector (Human) (pPM-C-His)

PV051580 500 ng
EUR 481

DYNLL1 Protein Vector (Mouse) (pPB-C-His)

PV173902 500 ng
EUR 603

DYNLL1 Protein Vector (Mouse) (pPB-N-His)

PV173903 500 ng
EUR 603

EXOSC9

EXOSC9 Antibody

47529-100ul 100ul
EUR 252

EXOSC9 antibody

10R-1518 100 ug
EUR 512
Description: Mouse monoclonal EXOSC9 antibody

EXOSC9 siRNA

20-abx901801
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOSC9 siRNA

20-abx915834
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOSC9 siRNA

20-abx915835
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOSC9 Conjugated Antibody

C47529 100ul
EUR 397

anti- EXOSC9 antibody

FNab02908 100µg
EUR 585
  • Immunogen: exosome component 9
  • Uniprot ID: Q06265
  • Gene ID: 5393
  • Research Area: Metabolism
Description: Antibody raised against EXOSC9

Anti-EXOSC9 antibody

PAab02908 100 ug
EUR 412

EXOSC9 ELISA KIT|Human

EF009485 96 Tests
EUR 689

Rat EXOSC9 shRNA Plasmid

20-abx988731
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EXOSC9 shRNA Plasmid

20-abx974156
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EXOSC9 shRNA Plasmid

20-abx953612
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOSC9 Recombinant Protein (Human)

RP057258 100 ug Ask for price

EXOSC9 Recombinant Protein (Rat)

RP200129 100 ug Ask for price