
ACRO Biosystems Recombinante eiwitten voor de biofarmaceutische industrie Gentaur ACROBiosystems is een toonaangevende fabrikant van recombinante eiwitten en andere kritische reagentia ter ondersteuning van de ontwikkeling van doeltherapie. Het bedrijf hanteert een toepassingsgerichte ontwikkelingsstrategie, met een bijzondere focus op productontwerp, kwaliteitscontrole en oplossingsgerichte ondersteuning. De producten en diensten van ACROBiosystems stellen iedereen op het gebied […]


VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]


Human USP17L8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-40358h 96 Tests
EUR 824
USP17L8 Recombinant Protein (Human)
RP106697 100 ug Ask for price
USP17L8 ORF Vector (Human) (pORF)
ORF035567 1.0 ug DNA Ask for price
USP17L8 Protein Vector (Human) (pPB-C-His)
PV142266 500 ng Ask for price
USP17L8 Protein Vector (Human) (pPB-N-His)
PV142267 500 ng Ask for price
USP17L8 Protein Vector (Human) (pPM-C-HA)
PV142268 500 ng Ask for price
USP17L8 Protein Vector (Human) (pPM-C-His)
PV142269 500 ng Ask for price
USP17L8 3'UTR GFP Stable Cell Line
TU077984 1.0 ml
EUR 2333
USP17L8 3'UTR Luciferase Stable Cell Line
TU027984 1.0 ml
EUR 2333
USP17L8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV789191 1.0 ug DNA
EUR 572
USP17L8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV789195 1.0 ug DNA
EUR 572
USP17L8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV789196 1.0 ug DNA
EUR 572
USP17L8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV789192 1.0 ug DNA
EUR 572
USP17L8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV789193 1.0 ug DNA
EUR 630
USP17L8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV789194 1.0 ug DNA
EUR 630


Human USP17L22 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


Product not found


Human A Disintegrin And Metalloproteinase With Thrombospondin 6 (ADAMTS6) ELISA Kit

EUR 725
  • Should the Human A Disintegrin And Metalloproteinase With Thrombospondin 6 (ADAMTS6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human A Disintegrin And Metalloproteinase With Thrombospondin 6 (ADAMTS6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human A Disintegrin And Metalloproteinase With Thrombospondin 6 (ADAMTS6) ELISA Kit

RDR-ADAMTS6-Hu-48Tests 48 Tests
EUR 589

Human A Disintegrin And Metalloproteinase With Thrombospondin 6 (ADAMTS6) ELISA Kit

RDR-ADAMTS6-Hu-96Tests 96 Tests
EUR 820

ADAMTS6 antibody

70R-10203 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ADAMTS6 antibody

ADAMTS6 Antibody

37083-100ul 100ul
EUR 252

ADAMTS6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS6. Recognizes ADAMTS6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50

ADAMTS6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS6. Recognizes ADAMTS6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS6 Blocking Peptide

33R-7435 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS6 antibody, catalog no. 70R-10203

ADAMTS6 Conjugated Antibody

C37083 100ul
EUR 397


ELA-E14609h 96 Tests
EUR 824


ELI-23889h 96 Tests
EUR 824


EF005779 96 Tests
EUR 689

Human ADAMTS6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAMTS6 ORF Vector (Human) (pORF)

ORF015302 1.0 ug DNA Ask for price

Adamts6 ORF Vector (Mouse) (pORF)

ORF038114 1.0 ug DNA
EUR 506

ADAMTS6 ELISA Kit (Human) (OKEH02364)

OKEH02364 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Adamts6 sgRNA CRISPR Lentivector set (Mouse)

K3297601 3 x 1.0 ug
EUR 339

ADAMTS6 sgRNA CRISPR Lentivector set (Human)

K0044101 3 x 1.0 ug
EUR 339

Adamts6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3297602 1.0 ug DNA
EUR 154

Adamts6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3297603 1.0 ug DNA
EUR 154

Adamts6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3297604 1.0 ug DNA
EUR 154

ADAMTS6 sgRNA CRISPR Lentivector (Human) (Target 1)

K0044102 1.0 ug DNA
EUR 154

ADAMTS6 sgRNA CRISPR Lentivector (Human) (Target 2)

K0044103 1.0 ug DNA
EUR 154

ADAMTS6 sgRNA CRISPR Lentivector (Human) (Target 3)

K0044104 1.0 ug DNA
EUR 154

ADAMTS6 Protein Vector (Mouse) (pPB-C-His)

PV152454 500 ng
EUR 1065

ADAMTS6 Protein Vector (Mouse) (pPB-N-His)

PV152455 500 ng
EUR 1065

ADAMTS6 Protein Vector (Mouse) (pPM-C-HA)

PV152456 500 ng
EUR 1065

ADAMTS6 Protein Vector (Mouse) (pPM-C-His)

PV152457 500 ng
EUR 1065

ADAMTS6 Protein Vector (Human) (pPB-His-MBP)

PV319894 500 ng Ask for price

ADAMTS6 Protein Vector (Human) (pPB-His-GST)

PV319895 500 ng Ask for price

ADAMTS6 Protein Vector (Human) (pPB-C-His)

PV061205 500 ng Ask for price

ADAMTS6 Protein Vector (Human) (pPB-N-His)

PV061206 500 ng Ask for price

ADAMTS6 Protein Vector (Human) (pPM-C-HA)

PV061207 500 ng Ask for price

ADAMTS6 Protein Vector (Human) (pPM-C-His)

PV061208 500 ng Ask for price

Adamts6 3'UTR Luciferase Stable Cell Line

TU101400 1.0 ml Ask for price

Adamts6 3'UTR GFP Stable Cell Line

TU151400 1.0 ml Ask for price

ADAMTS6 3'UTR GFP Stable Cell Line

TU050321 1.0 ml
EUR 4617

ADAMTS6 3'UTR Luciferase Stable Cell Line

TU000321 1.0 ml
EUR 4617

ADAMTS6 Protein Vector (Human) (pPM-N-D-C-HA)

PV319896 500 ng Ask for price

ADAMTS6 Protein Vector (Human) (pPM-N-D-C-His)

PV319897 500 ng Ask for price

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 6 (ADAMTS6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 6 (ADAMTS6) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adamts6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3297605 3 x 1.0 ug
EUR 376

ADAMTS6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0044105 3 x 1.0 ug
EUR 376

Adamts6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3297606 1.0 ug DNA
EUR 167

Adamts6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3297607 1.0 ug DNA
EUR 167

Adamts6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3297608 1.0 ug DNA
EUR 167

ADAMTS6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0044106 1.0 ug DNA
EUR 167

ADAMTS6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0044107 1.0 ug DNA
EUR 167


Human Beta-1,4-Galactosyltransferase 1 (b4GALT1) ELISA Kit

DLR-b4GALT1-Hu-96T 96T
EUR 647
  • Should the Human Beta-1,4-Galactosyltransferase 1 (b4GALT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Beta-1,4-Galactosyltransferase 1 (b4GALT1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Beta-1,4-Galactosyltransferase 1 (b4GALT1) ELISA Kit

RDR-b4GALT1-Hu-48Tests 48 Tests
EUR 522

Human Beta-1,4-Galactosyltransferase 1 (b4GALT1) ELISA Kit

RDR-b4GALT1-Hu-96Tests 96 Tests
EUR 724

Human Beta-1,4-Galactosyltransferase 1 (b4GALT1) ELISA Kit

RD-b4GALT1-Hu-48Tests 48 Tests
EUR 500

Human Beta-1,4-Galactosyltransferase 1 (b4GALT1) ELISA Kit

RD-b4GALT1-Hu-96Tests 96 Tests
EUR 692

B4galt1/ Rat B4galt1 ELISA Kit

ELI-33392r 96 Tests
EUR 886

B4GALT1 Antibody

34492-100ul 100ul
EUR 252

B4GALT1 Antibody

34492-50ul 50ul
EUR 187

B4GALT1 Antibody

DF3839 200ul
EUR 304
Description: B4GALT1 Antibody detects endogenous levels of total B4GALT1.

B4GALT1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against B4GALT1. Recognizes B4GALT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

B4GALT1 Antibody

CSB-PA195029-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against B4GALT1. Recognizes B4GALT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

B4GALT1 antibody

70R-36279 100 ug
EUR 327
Description: Rabbit polyclonal B4GALT1 antibody

B4GALT1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against B4GALT1. Recognizes B4GALT1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALT1 Antibody

ABD3839 100 ug
EUR 438

B4GALT1 Blocking Peptide

DF3839-BP 1mg
EUR 195

B4GALT1 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

B4GALT1 Conjugated Antibody

C34492 100ul
EUR 397

B4GALT1 Rabbit pAb

A8546-100ul 100 ul
EUR 308

B4GALT1 Rabbit pAb

A8546-200ul 200 ul
EUR 459

B4GALT1 Rabbit pAb

A8546-20ul 20 ul
EUR 183

B4GALT1 Rabbit pAb

A8546-50ul 50 ul
EUR 223

pMD-B4GALT1 Plasmid

PVTB00833 2 ug
EUR 356

Anti-B4GALT1 antibody

STJ111285 100 µl
EUR 277
Description: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene is unique among the beta4GalT genes because it encodes an enzyme that participates both in glycoconjugate and lactose biosynthesis. For the first activity, the enzyme adds galactose to N-acetylglucosamine residues that are either monosaccharides or the nonreducing ends of glycoprotein carbohydrate chains. The second activity is restricted to lactating mammary tissues where the enzyme forms a heterodimer with alpha-lactalbumin to catalyze UDP-galactose + D-glucose UDP + lactose. The two enzymatic forms result from alternate transcription initiation sites and post-translational processing. Two transcripts, which differ only at the 5' end, with approximate lengths of 4.1 kb and 3.9 kb encode the same protein. The longer transcript encodes the type II membrane-bound, trans-Golgi resident protein involved in glycoconjugate biosynthesis. The shorter transcript encodes a protein which is cleaved to form the soluble lactose synthase.

Human β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E01B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E01B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E01B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E03B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E03B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E03B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E06B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E06B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E06B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E04B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E04B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E04B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E02B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E02B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E02B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E08B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E08B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E08B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E07B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E07B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E07B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E09B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E09B0714-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E09B0714-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 ELISA kit

E05B0714-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β 1,4 galactosyltransferase 1(B4GALT1)B4GALT1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

C1GALT1 antibody

70R-7429 50 ug
EUR 467
Description: Rabbit polyclonal C1GALT1 antibody raised against the middle region of C1GALT1

C1GALT1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1GALT1. Recognizes C1GALT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500


YF-PA26439 50 ul
EUR 334
Description: Mouse polyclonal to C1GALT1

C1GALT1 Rabbit pAb

A12865-100ul 100 ul
EUR 308

C1GALT1 Rabbit pAb

A12865-200ul 200 ul
EUR 459

C1GALT1 Rabbit pAb

A12865-20ul 20 ul
EUR 183

C1GALT1 Rabbit pAb

A12865-50ul 50 ul
EUR 223

C1GALT1 Polyclonal Antibody

A70295 100 ?g
EUR 628.55
Description: fast delivery possible

C1GALT1 Blocking Peptide

33R-6911 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C1GALT1 antibody, catalog no. 70R-7429

C1GALT1 Polyclonal Antibody

27821-100ul 100ul
EUR 252

C1GALT1 Polyclonal Antibody

27821-50ul 50ul
EUR 187

Anti-C1GALT1 antibody

STJ114731 100 µl
EUR 277
Description: The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.

Anti-C1GALT1 (1F1)

YF-MA11592 100 ug
EUR 363
Description: Mouse monoclonal to C1GALT1

Polyclonal C1GALT1 Antibody (Center)

APR04571G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human C1GALT1 (Center). This antibody is tested and proven to work in the following applications:

C1GALT1 Polyclonal Conjugated Antibody

C27821 100ul
EUR 397

Mouse C1GALT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat C1GALT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse C1galt1 ELISA KIT

ELI-07389m 96 Tests
EUR 865


ELI-07391c 96 Tests
EUR 928


ELI-07392h 96 Tests
EUR 824


ELI-07393b 96 Tests
EUR 928

C1GALT1 protein (His tag)

80R-2886 50 ug
EUR 424
Description: Purified recombinant C1GALT1 protein (His tag)

Human C1GALT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

C1GALT1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1GALT1. Recognizes C1GALT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C1GALT1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1GALT1. Recognizes C1GALT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

C1GALT1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1GALT1. Recognizes C1GALT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

C1GALT1 Recombinant Protein (Human)

RP049564 100 ug Ask for price

C1GALT1 Recombinant Protein (Rat)

RP192611 100 ug Ask for price

C1GALT1 Recombinant Protein (Mouse)

RP120230 100 ug Ask for price

C1GALT1 Polyclonal Antibody, HRP Conjugated

A70296 100 ?g
EUR 628.55
Description: reagents widely cited

C1GALT1 Polyclonal Antibody, FITC Conjugated

A70297 100 ?g
EUR 628.55
Description: Ask the seller for details

C1GALT1 Polyclonal Antibody, Biotin Conjugated

A70298 100 ?g
EUR 628.55
Description: The best epigenetics products

C1galt1 ORF Vector (Mouse) (pORF)

ORF040078 1.0 ug DNA
EUR 506

C1GALT1 ORF Vector (Human) (pORF)

ORF016522 1.0 ug DNA
EUR 405

C1galt1 ORF Vector (Rat) (pORF)

ORF064205 1.0 ug DNA
EUR 506

C1GALT1 ELISA Kit (Rat) (OKEH06021)

OKEH06021 96 Wells
EUR 662
Description: Description of target: Glycosyltransferase that generates the core 1 O-glycan Gal-beta1-3GalNAc-alpha1-Ser/Thr (T antigen), which is a precursor for many extended O-glycans in glycoproteins. Plays a central role in many processes, such as angiogenesis, thrombopoiesis and kidney homeostasis development.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

C1GALT1 sgRNA CRISPR Lentivector set (Human)

K0008101 3 x 1.0 ug
EUR 339

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

  • EUR 342.00
  • EUR 230.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1-Specific Chaperone 1 (C1GALT1C1) Antibody

  • EUR 342.00
  • EUR 230.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C1GALT1 sgRNA CRISPR Lentivector set (Mouse)

K3003801 3 x 1.0 ug
EUR 339

C1galt1 sgRNA CRISPR Lentivector set (Rat)

K6990901 3 x 1.0 ug
EUR 339

Monoclonal C1GALT1 Antibody (monoclonal) (M01), Clone: 1F1

AMM03301G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human C1GALT1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1F1. This antibody is applicable in WB and IHC, E

C1GALT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0008102 1.0 ug DNA
EUR 154

C1GALT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0008103 1.0 ug DNA
EUR 154

C1GALT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0008104 1.0 ug DNA
EUR 154

C1GALT1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3003802 1.0 ug DNA
EUR 154

C1GALT1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3003803 1.0 ug DNA
EUR 154

C1GALT1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3003804 1.0 ug DNA
EUR 154

C1galt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6990902 1.0 ug DNA
EUR 154

C1galt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6990903 1.0 ug DNA
EUR 154

C1galt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6990904 1.0 ug DNA
EUR 154

C1GALT1 Protein Vector (Human) (pPB-C-His)

PV066085 500 ng
EUR 552

C1GALT1 Protein Vector (Human) (pPB-N-His)

PV066086 500 ng
EUR 552

C1GALT1 Protein Vector (Human) (pPM-C-HA)

PV066087 500 ng
EUR 552

C1GALT1 Protein Vector (Human) (pPM-C-His)

PV066088 500 ng
EUR 552

Recombinant Human C1GALT1 Protein, His, E.coli-10ug

QP11227-10ug 10ug
EUR 201

Recombinant Human C1GALT1 Protein, His, E.coli-1mg

QP11227-1mg 1mg
EUR 5251

Recombinant Human C1GALT1 Protein, His, E.coli-2ug

QP11227-2ug 2ug
EUR 155

C1GALT1 Protein Vector (Human) (pPB-His-MBP)

PV329754 500 ng
EUR 552

C1GALT1 Protein Vector (Human) (pPB-His-GST)

PV329755 500 ng
EUR 552

C1GALT1 Protein Vector (Rat) (pPB-C-His)

PV256818 500 ng
EUR 603

C1GALT1 Protein Vector (Rat) (pPB-N-His)

PV256819 500 ng
EUR 603

C1GALT1 Protein Vector (Rat) (pPM-C-HA)

PV256820 500 ng
EUR 603

C1GALT1 Protein Vector (Rat) (pPM-C-His)

PV256821 500 ng
EUR 603

C1GALT1 Protein Vector (Mouse) (pPB-C-His)

PV160310 500 ng
EUR 603

C1GALT1 Protein Vector (Mouse) (pPB-N-His)

PV160311 500 ng
EUR 603

C1GALT1 Protein Vector (Mouse) (pPM-C-HA)

PV160312 500 ng
EUR 603

C1GALT1 Protein Vector (Mouse) (pPM-C-His)

PV160313 500 ng
EUR 603

C1galt1 3'UTR Luciferase Stable Cell Line

TU201486 1.0 ml Ask for price

C1galt1 3'UTR GFP Stable Cell Line

TU152928 1.0 ml Ask for price

C1GALT1 3'UTR Luciferase Stable Cell Line

TU002000 1.0 ml
EUR 1394

C1galt1 3'UTR Luciferase Stable Cell Line

TU102928 1.0 ml Ask for price

C1GALT1 3'UTR GFP Stable Cell Line

TU052000 1.0 ml
EUR 1394

C1galt1 3'UTR GFP Stable Cell Line

TU251486 1.0 ml Ask for price

Goat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E06C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E06C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E06C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E02C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E02C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E02C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E03C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E03C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E03C1229-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E04C1229-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) ELISA kit

E04C1229-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit C1GALT1 specific chaperone 1(C1GALT1C1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


Product not found


NUP160 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP160 antibody

70R-50890 100 ul
EUR 244
Description: Purified Polyclonal NUP160 antibody

NUP160 Antibody

ABD4251 100 ug
EUR 438

NUP160 Antibody

24723-100ul 100ul
EUR 390

NUP160 antibody

70R-19002 50 ul
EUR 435
Description: Rabbit polyclonal NUP160 antibody

NUP160 Antibody

DF4251 200ul
EUR 304
Description: NUP160 Antibody detects endogenous levels of total NUP160.

NUP160 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUP160. Recognizes NUP160 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NUP160 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NUP160. Recognizes NUP160 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal NUP160 Antibody

APR06491G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP160 . This antibody is tested and proven to work in the following applications:

NUP160 cloning plasmid

CSB-CL614254HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 573
  • Sequence: atggcggcggcgggagccctggaacggagcttcgtggagctaagcggagctgagcgcgaaaggccgaggcactttcgggaattcacagtctgcagcattgggactgcaaatgccgtggctggcgccgtaaaatacagtgaaagcgcgggaggcttttactacgtggagagtggcaa
  • Show more
Description: A cloning plasmid for the NUP160 gene.

NUP160 cloning plasmid

CSB-CL614254HU2-10ug 10ug
EUR 1687
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4311
  • Show more
Description: A cloning plasmid for the NUP160 gene.

Nup160 Polyclonal Antibody

ES5327-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nup160 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nup160 Polyclonal Antibody

ES5327-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nup160 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- NUP160 antibody

FNab05922 100µg
EUR 548.75
  • Immunogen: nucleoporin 160kDa
  • Uniprot ID: Q12769
  • Gene ID: 23279
  • Research Area: Metabolism
Description: Antibody raised against NUP160

NUP160 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Nup160 Polyclonal Antibody

ABP54328-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of Nup160 from Human, Mouse. This Nup160 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450

Nup160 Polyclonal Antibody

ABP54328-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of Nup160 from Human, Mouse. This Nup160 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450

Nup160 Polyclonal Antibody

ABP54328-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450
  • Applications tips:
Description: A polyclonal antibody for detection of Nup160 from Human, Mouse. This Nup160 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup160 at AA rangle: 370-450

Anti-Nup160 Antibody

A05629 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Nup160 Antibody (NUP160) detection. Tested with WB in Human, Mouse.

NUP160 Rabbit pAb

A13080-100ul 100 ul
EUR 308

NUP160 Rabbit pAb

A13080-200ul 200 ul
EUR 459

NUP160 Rabbit pAb

A13080-20ul 20 ul
EUR 183

NUP160 Rabbit pAb

A13080-50ul 50 ul
EUR 223

NUP160 Rabbit pAb

A9161-100ul 100 ul
EUR 308

NUP160 Rabbit pAb

A9161-200ul 200 ul
EUR 459

NUP160 Rabbit pAb

A9161-20ul 20 ul
EUR 183

NUP160 Rabbit pAb

A9161-50ul 50 ul Ask for price

Nup160 Polyclonal Antibody

41259-100ul 100ul
EUR 252

Nup160 Polyclonal Antibody

41259-50ul 50ul
EUR 187

NUP160 Blocking Peptide

DF4251-BP 1mg
EUR 195

Anti-NUP160 antibody

PAab05922 100 ug
EUR 386

Anti-Nup160 antibody

STJ94576 200 µl
EUR 197
Description: Nup160 is a protein encoded by the NUP160 gene which is approximately 162,1 kDa. Nup160 is localised to the nucleus and is involved in the transport of the SLBP independent mature mRNA, the HIV life cycle, cell cycle and influenza viral RNA transcription and replication. NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport and is involved in polyA RNA transport. NUp160 is expressed in the bone marrow, intestine, liver, muscle and skin. STJ94576 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of Nup160 protein.

Anti-NUP160 antibody

STJ111592 100 µl
EUR 277

Anti-NUP160 antibody

STJ115047 100 µl
EUR 277

Mouse Nuclear pore complex protein Nup160, Nup160 ELISA KIT

ELI-21357m 96 Tests
EUR 865

Human Nuclear pore complex protein Nup160, NUP160 ELISA KIT

ELI-38240h 96 Tests
EUR 824

Nup160 Polyclonal Conjugated Antibody

C41259 100ul
EUR 397

Polyclonal NUP160 Antibody (Center)

APR03617G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP160 (Center). This antibody is tested and proven to work in the following applications:

Mouse NUP160 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NUP160 ELISA Kit

EHN0059 96Tests
EUR 521

Goat NUP160 ELISA Kit

EGTN0059 96Tests
EUR 521

Bovine NUP160 ELISA Kit

EBN0059 96Tests
EUR 521

Canine NUP160 ELISA Kit

ECN0059 96Tests
EUR 521

Anserine NUP160 ELISA Kit

EAN0059 96Tests
EUR 521


EF001387 96 Tests
EUR 689

Porcine NUP160 ELISA Kit

EPN0059 96Tests
EUR 521

Rat NUP160 ELISA Kit

ERN0059 96Tests
EUR 521

Rabbit NUP160 ELISA Kit

ERTN0059 96Tests
EUR 521

Mouse NUP160 ELISA Kit

EMN0059 96Tests
EUR 521

Nucleoporin 160 (NUP160) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Nucleoporin 160 (NUP160) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Nucleoporin 160 (NUP160) Antibody

abx026445-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleoporin 160 (NUP160) Antibody

abx026445-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleoporin 160 (NUP160) Antibody

abx235922-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human NUP160 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Nucleoporin 160kDa (NUP160)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.3kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Nucleoporin 160kDa expressed in: E.coli

Recombinant Nucleoporin 160kDa (NUP160)

  • EUR 528.29
  • EUR 244.00
  • EUR 1706.08
  • EUR 635.36
  • EUR 1170.72
  • EUR 416.00
  • EUR 4115.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z0W3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.2kDa
  • Isoelectric Point: 6.7
Description: Recombinant Mouse Nucleoporin 160kDa expressed in: E.coli

Guinea Pig NUP160 ELISA Kit

EGN0059 96Tests
EUR 521

Nucleoporin 160 kDa (NUP160) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 160 kDa (NUP160) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 160 kDa (NUP160) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 160 kDa (NUP160) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUP160 ORF Vector (Human) (pORF)

ORF007303 1.0 ug DNA
EUR 95

Nup160 ORF Vector (Rat) (pORF)

ORF071615 1.0 ug DNA
EUR 2080

NUP160 ORF Vector (Human) (pORF)

ORF013928 1.0 ug DNA
EUR 95

Nup160 ORF Vector (Mouse) (pORF)

ORF051824 1.0 ug DNA
EUR 506

NUP160 ELISA Kit (Mouse) (OKEI00494)

OKEI00494 96 Wells
EUR 767
Description: Description of target: Involved in poly(A)+ RNA transport.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Mouse NUP160(Nucleoporin 160kDa) ELISA Kit

EM1247 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9Z0W3
  • Alias: NUP160/Nuclear pore complex protein Nup160/Nucleoporin Nup160/160 kDa nucleoporin/Gene trap locus 1-13 protein(GTL-13)/
Description: Method of detection: Double Antibody, Sandwich ELISA ;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse Nucleoporin 160 kDa (NUP160) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

NUP160 sgRNA CRISPR Lentivector set (Human)

K1469201 3 x 1.0 ug
EUR 339

Nup160 sgRNA CRISPR Lentivector set (Rat)

K6586401 3 x 1.0 ug
EUR 339

Human Nucleoporin 160kDa(NUP160)ELISA Kit

QY-E05259 96T
EUR 361

Monkey Nucleoporin 160 kDa (NUP160) ELISA Kit

abx359881-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Nucleoporin 160 kDa (NUP160) ELISA Kit

abx361587-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Nucleoporin 160 kDa (NUP160) ELISA Kit

abx363253-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Mouse NUP160 (Nucleoporin 160kDa)

E-EL-M0850 1 plate of 96 wells
EUR 534
  • Gentaur's NUP160 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP160. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse NUP160 (Nucleoporin 160kDa) in samples from Serum, Plasma, Cell supernatant

Rat Nucleoporin 160 kDa (NUP160) ELISA Kit

abx353807-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Nucleoporin 160 kDa (NUP160) ELISA Kit

abx381930-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Nucleoporin 160 kDa (NUP160) ELISA Kit

abx356738-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Nucleoporin 160 kDa (NUP160) ELISA Kit

abx254304-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Nucleoporin 160 kDa (NUP160) CLIA Kit

abx197369-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

NUP160 sgRNA CRISPR Lentivector (Human) (Target 1)

K1469202 1.0 ug DNA
EUR 154

NUP160 sgRNA CRISPR Lentivector (Human) (Target 2)

K1469203 1.0 ug DNA
EUR 154

NUP160 sgRNA CRISPR Lentivector (Human) (Target 3)

K1469204 1.0 ug DNA
EUR 154

CLIA kit for Mouse NUP160 (Nucleoporin 160kDa)

E-CL-M0523 1 plate of 96 wells
EUR 584
  • Gentaur's NUP160 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP160 . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse NUP160 (Nucleoporin 160kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat NUP160 (Nucleoporin 160kDa)

E-EL-R0680 1 plate of 96 wells
EUR 534
  • Gentaur's NUP160 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat NUP160. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat NUP160 (Nucleoporin 160kDa) in samples from Serum, Plasma, Cell supernatant

Nup160 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6586402 1.0 ug DNA
EUR 154

Nup160 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6586403 1.0 ug DNA
EUR 154

Nup160 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6586404 1.0 ug DNA
EUR 154

Nucleoporin 160kDa (NUP160) Polyclonal Antibody (Human, Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP160 (Phe11~Val206)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Nucleoporin 160kDa (NUP160)

NUP160 Protein Vector (Human) (pPB-C-His)

PV055709 500 ng
EUR 481

NUP160 Protein Vector (Human) (pPB-N-His)

PV055710 500 ng
EUR 481

NUP160 Protein Vector (Human) (pPM-C-HA)

PV055711 500 ng
EUR 481

NUP160 Protein Vector (Human) (pPM-C-His)

PV055712 500 ng
EUR 481

NUP160 Protein Vector (Human) (pPB-C-His)

PV029209 500 ng
EUR 329


RAD23A antibody

70R-1037 100 ug
EUR 377
Description: Rabbit polyclonal RAD23A antibody

RAD23A antibody

70R-19745 50 ul
EUR 435
Description: Rabbit polyclonal RAD23A antibody

RAD23A antibody

38627-100ul 100ul
EUR 252

RAD23A Antibody

DF3632 200ul
EUR 304
Description: RAD23A Antibody detects endogenous levels of total RAD23A.

RAD23A Antibody

DF7241 200ul
EUR 304
Description: RAD23A Antibody detects endogenous levels of total RAD23A.

RAD23A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAD23A Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

RAD23A antibody

70R-33857 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody

RAD23A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAD23A. Recognizes RAD23A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAD23A Antibody

ABD3632 100 ug
EUR 438

RAD23A Antibody

ABD7241 100 ug
EUR 438

RAD23A Blocking Peptide

33R-3339 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23A antibody, catalog no. 70R-1037

RAD23A Blocking Peptide

33R-9737 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAD23A antibody, catalog no. 70R-1034

RAD23A antibody (HRP)

60R-1368 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody (HRP)

RAD23A antibody (FITC)

60R-1369 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody (FITC)

RAD23A antibody (biotin)

60R-1370 100 ug
EUR 327
Description: Rabbit polyclonal RAD23A antibody (biotin)

RAD23A Blocking Peptide

DF3632-BP 1mg
EUR 195

RAD23A Blocking Peptide

DF7241-BP 1mg
EUR 195

RAD23A Conjugated Antibody

C38627 100ul
EUR 397

RAD23A cloning plasmid

CSB-CL019259HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atggccgtcaccatcacgctcaaaacgctgcagcagcagaccttcaagatccgcatggagcctgacgagacggtgaaggtgctaaaggagaagatagaagctgagaagggtcgtgatgccttccccgtggctggacagaaactcatctatgccggcaagatcttgagtgacgatg
  • Show more
Description: A cloning plasmid for the RAD23A gene.

RAD23A Rabbit pAb

A3188-100ul 100 ul
EUR 308

RAD23A Rabbit pAb

A3188-200ul 200 ul
EUR 459

RAD23A Rabbit pAb

A3188-20ul 20 ul
EUR 183

RAD23A Rabbit pAb

A3188-50ul 50 ul
EUR 223

RAD23A Polyclonal Antibody

A53961 100 µg
EUR 570.55
Description: fast delivery possible

Rad23A Polyclonal Antibody

ABP55970-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

Rad23A Polyclonal Antibody

ABP55970-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of Rad23A from Human, Mouse. This Rad23A antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Rad23A at AA range: 60-140

Rad23A Polyclonal Antibody