Genomics Overzicht

  Genetische Manipulaties AAV (Adeno Associated Virus) productlijn Geacetyleerde histondetectie Geacetyleerd histon-doelonderzoek Adenovirus-productlijn Biochemicaliën Capillaire elektroforese DNA-sequencing (Sanger-sequencing) cDNA-klonen cDNA-normalisatie cDNA-standaarden cDNA-synthese Hulpmiddelen voor celbeplating Cell Tracking door genetische NGS-streepjescode-etikettering Chromatine-analyse Circulerende histon kwantificering Kloon Screening Kits Klonen en expressievectoren Kits voor het klonen Kloondiensten Competente E. coli-cellen Competente Vibrio natriegens-cellen DNA-versterking DNA- en histon-demethylase-assays […]

ACROBiosystems

ACRO Biosystems Recombinante eiwitten voor de biofarmaceutische industrie Gentaur ACROBiosystems is een toonaangevende fabrikant van recombinante eiwitten en andere kritische reagentia ter ondersteuning van de ontwikkeling van doeltherapie. Het bedrijf hanteert een toepassingsgerichte ontwikkelingsstrategie, met een bijzondere focus op productontwerp, kwaliteitscontrole en oplossingsgerichte ondersteuning. De producten en diensten van ACROBiosystems stellen iedereen op het gebied […]

BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

PRKN

Parkin (PRKN) Antibody

20-abx133269
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

20-abx013170
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032820-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032820-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032821-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032821-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx236149-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Parkin (PRKN) Antibody

20-abx329459
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx332454-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

20-abx324391
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-PRKN Antibody

STJ502119 100 µg
EUR 476

Anti-Parkin/PRKN Antibody

PB9307 100ug/vial
EUR 334

Anti-PRKN Antibody (Biotin)

STJ502120 100 µg
EUR 586

Anti-PRKN Antibody (FITC)

STJ502121 100 µg
EUR 586

PRKN ELISA Kit (Rat) (OKEH08514)

OKEH08514 96 Wells
EUR 896
Description: Description of target: localized to the cytoplasm in neurons of many regions of the brain; has N-terminal ubiquitin and ring-IBR-ring finger domains [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10pg/mL

Parkin Phospho-Ser131 (PRKN pS131) Antibody

20-abx322972
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human E3 ubiquitin-protein ligase parkin (PRKN)

1-CSB-EP017451HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase parkin(PRKN) expressed in E.coli

Human E3 ubiquitin-protein ligase parkin (PRKN)

1-CSB-BP017451HU
  • EUR 593.00
  • EUR 255.00
  • EUR 1481.00
  • EUR 791.00
  • EUR 1086.00
  • EUR 347.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase parkin(PRKN) expressed in Baculovirus

PROZ

Human Protein Z (PROZ) ELISA Kit

DLR-PROZ-Hu-96T 96T
EUR 621
  • Should the Human Protein Z (PROZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Z (PROZ) in samples from plasma.

Mouse Protein Z (PROZ) ELISA Kit

DLR-PROZ-Mu-48T 48T
EUR 489
  • Should the Mouse Protein Z (PROZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Protein Z (PROZ) in samples from plasma.

Mouse Protein Z (PROZ) ELISA Kit

DLR-PROZ-Mu-96T 96T
EUR 635
  • Should the Mouse Protein Z (PROZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Protein Z (PROZ) in samples from plasma.

Human Protein Z (PROZ) ELISA Kit

RDR-PROZ-Hu-48Tests 48 Tests
EUR 500

Human Protein Z (PROZ) ELISA Kit

RDR-PROZ-Hu-96Tests 96 Tests
EUR 692

Mouse Protein Z (PROZ) ELISA Kit

RDR-PROZ-Mu-48Tests 48 Tests
EUR 511

Mouse Protein Z (PROZ) ELISA Kit

RDR-PROZ-Mu-96Tests 96 Tests
EUR 709

Human Protein Z (PROZ) ELISA Kit

RD-PROZ-Hu-48Tests 48 Tests
EUR 478

Human Protein Z (PROZ) ELISA Kit

RD-PROZ-Hu-96Tests 96 Tests
EUR 662

Mouse Protein Z (PROZ) ELISA Kit

RD-PROZ-Mu-48Tests 48 Tests
EUR 489

Mouse Protein Z (PROZ) ELISA Kit

RD-PROZ-Mu-96Tests 96 Tests
EUR 677

PROZ antibody

10R-1813 100 ul
EUR 403
Description: Mouse monoclonal PROZ antibody

PROZ siRNA

20-abx929902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROZ siRNA

20-abx929903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROZ Polyclonal Antibody

29714-100ul 100ul
EUR 252

PROZ Polyclonal Antibody

29714-50ul 50ul
EUR 187

PROZ Polyclonal Antibody

29715-100ul 100ul
EUR 252

PROZ Polyclonal Antibody

29715-50ul 50ul
EUR 187

PROZ Rabbit pAb

A16082-100ul 100 ul
EUR 308

PROZ Rabbit pAb

A16082-200ul 200 ul
EUR 459

PROZ Rabbit pAb

A16082-20ul 20 ul
EUR 183

PROZ Rabbit pAb

A16082-50ul 50 ul
EUR 223

PROZ Rabbit pAb

A16083-100ul 100 ul
EUR 308

PROZ Rabbit pAb

A16083-200ul 200 ul
EUR 459

PROZ Rabbit pAb

A16083-20ul 20 ul
EUR 183

PROZ Rabbit pAb

A16083-50ul 50 ul
EUR 223

anti-PROZ (2B4)

LF-MA30302 100 ul
EUR 486
Description: Mouse Monoclonal to PROZ

Anti-PROZ antibody

STJ118535 100 µl
EUR 277

Anti-PROZ antibody

STJ118536 100 µl
EUR 277

Protein Z (PROZ) Antibody

20-abx178183
  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protein Z (PROZ) Antibody

20-abx178184
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protein Z (PROZ) Antibody

20-abx129390
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Z (PROZ) Antibody

20-abx174291
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human PROZ ELISA Kit

ELA-E0736h 96 Tests
EUR 824

Human ProZ ELISA Kit

EHP0152 96Tests
EUR 521

Bovine ProZ ELISA Kit

EBP0152 96Tests
EUR 521

Anserini ProZ ELISA Kit

EAP0152 96Tests
EUR 521

Chicken ProZ ELISA Kit

ECKP0152 96Tests
EUR 521

Canine ProZ ELISA Kit

ECP0152 96Tests
EUR 521

Goat ProZ ELISA Kit

EGTP0152 96Tests
EUR 521

PROZ ELISA KIT|Human

EF000977 96 Tests
EUR 689

Mouse PROZ shRNA Plasmid

20-abx975849
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PROZ Polyclonal Conjugated Antibody

C29714 100ul
EUR 397

PROZ Polyclonal Conjugated Antibody

C29715 100ul
EUR 397

Human PROZ shRNA Plasmid

20-abx955850
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine ProZ ELISA Kit

EPP0152 96Tests
EUR 521

Sheep ProZ ELISA Kit

ESP0152 96Tests
EUR 521

Rat ProZ ELISA Kit

ERP0152 96Tests
EUR 521

Rabbit ProZ ELISA Kit

ERTP0152 96Tests
EUR 521

Monkey ProZ ELISA Kit

EMKP0152 96Tests
EUR 521

Mouse ProZ ELISA Kit

EMP0152 96Tests
EUR 521

Recombinant Protein Z (PROZ)

4-RPA736Mu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CQW3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 71.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Protein Z expressed in: E.coli

PROZ Recombinant Protein (Human)

RP085035 100 ug Ask for price

PROZ Recombinant Protein (Mouse)

RP164777 100 ug Ask for price

Mouse Protein Z (PROZ) Protein

20-abx167987
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

OTOA

OTOA siRNA

20-abx927444
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Otoancorin (OTOA) Antibody

abx026120-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Otoancorin (OTOA) Antibody

abx026120-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

OTOA cloning plasmid

CSB-CL017271HU-10ug 10ug
EUR 1214
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3420
  • Sequence: ATGTCTCAGGAACCTACGACATACTCCCTTTTCCTATTCCTTTTTCTGAGCCATGGAGTGTCGAGTTATACAGTGCCAAATTCCAGGCAGGATTTGCATCCATTGTTGCAAAACATGGCGGAAGAAATAATAGATGGAAGCTATCTGAATGCACTGCTGGATCTCATACAGTTTC
  • Show more
Description: A cloning plasmid for the OTOA gene.

Human OTOA shRNA Plasmid

20-abx965458
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse OTOA shRNA Plasmid

20-abx982809
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal OTOA Antibody (N-term)

APR14234G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OTOA (N-term). This antibody is tested and proven to work in the following applications:

Mouse Otoancorin, Otoa ELISA KIT

ELI-37019m 96 Tests
EUR 865

Human Otoancorin, OTOA ELISA KIT

ELI-37638h 96 Tests
EUR 824

OTOA ORF Vector (Human) (pORF)

ORF013986 1.0 ug DNA
EUR 354

Otoa ORF Vector (Mouse) (pORF)

ORF053199 1.0 ug DNA
EUR 506

Human Otoancorin(OTOA)ELISA Kit

QY-E04722 96T
EUR 394

Otoa sgRNA CRISPR Lentivector set (Mouse)

K3588401 3 x 1.0 ug
EUR 339

OTOA sgRNA CRISPR Lentivector set (Human)

K1576301 3 x 1.0 ug
EUR 339

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3588402 1.0 ug DNA
EUR 154

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3588403 1.0 ug DNA
EUR 154

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3588404 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 1)

K1576302 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 2)

K1576303 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 3)

K1576304 1.0 ug DNA
EUR 154

OTOA Protein Vector (Mouse) (pPB-C-His)

PV212794 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPB-N-His)

PV212795 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPM-C-HA)

PV212796 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPM-C-His)

PV212797 500 ng
EUR 1065

OTOA Protein Vector (Human) (pPB-C-His)

PV055941 500 ng
EUR 481

OTOA Protein Vector (Human) (pPB-N-His)

PV055942 500 ng
EUR 481

OTOA Protein Vector (Human) (pPM-C-HA)

PV055943 500 ng
EUR 481

OTOA Protein Vector (Human) (pPM-C-His)

PV055944 500 ng
EUR 481

Otoa 3'UTR Luciferase Stable Cell Line

TU115764 1.0 ml Ask for price

Otoa 3'UTR GFP Stable Cell Line

TU165764 1.0 ml Ask for price

Otoa 3'UTR GFP Stable Cell Line

TU265684 1.0 ml Ask for price

Otoa 3'UTR Luciferase Stable Cell Line

TU215684 1.0 ml Ask for price

OTOA 3'UTR GFP Stable Cell Line

TU067194 1.0 ml
EUR 1394

OTOA 3'UTR Luciferase Stable Cell Line

TU017194 1.0 ml
EUR 1394

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3588405 3 x 1.0 ug
EUR 376

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1576305 3 x 1.0 ug
EUR 376

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3588406 1.0 ug DNA
EUR 167

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3588407 1.0 ug DNA
EUR 167

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3588408 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1576306 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1576307 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1576308 1.0 ug DNA
EUR 167

PIGB

PIGB siRNA

20-abx928560
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGB antibody

70R-19282 50 ul
EUR 435
Description: Rabbit polyclonal PIGB antibody

PIGB Antibody

1-CSB-PA017967GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PIGB. Recognizes PIGB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti- PIGB antibody

FNab06439 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class B
  • Uniprot ID: Q92521
  • Gene ID: 9488
  • Research Area: Metabolism
Description: Antibody raised against PIGB

Anti-PIGB antibody

PAab06439 100 ug
EUR 386

Anti-PIGB (2G7)

YF-MA16881 100 ug
EUR 363
Description: Mouse monoclonal to PIGB

Mouse PIGB shRNA Plasmid

20-abx974574
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGB ELISA KIT|Human

EF001775 96 Tests
EUR 689

Human PIGB shRNA Plasmid

20-abx956300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGB Recombinant Protein (Human)

RP083250 100 ug Ask for price

PIGB Recombinant Protein (Rat)

RP220466 100 ug Ask for price

PIGB Recombinant Protein (Mouse)

RP162017 100 ug Ask for price

PIGB ORF Vector (Human) (pORF)

ORF027751 1.0 ug DNA
EUR 405

Pigb ORF Vector (Rat) (pORF)

ORF073490 1.0 ug DNA
EUR 506

Pigb ORF Vector (Mouse) (pORF)

ORF054007 1.0 ug DNA
EUR 506

PIGB sgRNA CRISPR Lentivector set (Human)

K1646801 3 x 1.0 ug
EUR 339

Pigb sgRNA CRISPR Lentivector set (Mouse)

K4762901 3 x 1.0 ug
EUR 339

Pigb sgRNA CRISPR Lentivector set (Rat)

K6227301 3 x 1.0 ug
EUR 339

Mouse GPI mannosyltransferase 3, Pigb ELISA KIT

ELI-12682m 96 Tests
EUR 865

Bovine GPI mannosyltransferase 3, PIGB ELISA KIT

ELI-20959b 96 Tests
EUR 928

Human GPI mannosyltransferase 3, PIGB ELISA KIT

ELI-45935h 96 Tests
EUR 824

PIGB sgRNA CRISPR Lentivector (Human) (Target 1)

K1646802 1.0 ug DNA
EUR 154

PIGB sgRNA CRISPR Lentivector (Human) (Target 2)

K1646803 1.0 ug DNA
EUR 154

PIGB sgRNA CRISPR Lentivector (Human) (Target 3)

K1646804 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4762902 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4762903 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4762904 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6227302 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6227303 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6227304 1.0 ug DNA
EUR 154

PIGB Protein Vector (Human) (pPB-C-His)

PV111002 500 ng
EUR 552

PIGB Protein Vector (Human) (pPB-N-His)

PV111003 500 ng
EUR 552

PIGB Protein Vector (Human) (pPM-C-HA)

PV111004 500 ng
EUR 552

PIGB Protein Vector (Human) (pPM-C-His)

PV111005 500 ng
EUR 552

PIGB Protein Vector (Mouse) (pPB-C-His)

PV216026 500 ng
EUR 603

PIGB Protein Vector (Mouse) (pPB-N-His)

PV216027 500 ng
EUR 603

PIGB Protein Vector (Mouse) (pPM-C-HA)

PV216028 500 ng
EUR 603

PIGB Protein Vector (Mouse) (pPM-C-His)

PV216029 500 ng
EUR 603

PIGB Protein Vector (Rat) (pPB-C-His)

PV293958 500 ng
EUR 603

PIGB Protein Vector (Rat) (pPB-N-His)

PV293959 500 ng
EUR 603

PIGB Protein Vector (Rat) (pPM-C-HA)

PV293960 500 ng
EUR 603

PIGB Protein Vector (Rat) (pPM-C-His)

PV293961 500 ng
EUR 603

Pigb 3'UTR GFP Stable Cell Line

TU166346 1.0 ml Ask for price

PIGB 3'UTR Luciferase Stable Cell Line

TU017928 1.0 ml
EUR 1394

Pigb 3'UTR Luciferase Stable Cell Line

TU116346 1.0 ml Ask for price

PIGB 3'UTR GFP Stable Cell Line

TU067928 1.0 ml
EUR 1394

Pigb 3'UTR GFP Stable Cell Line

TU266225 1.0 ml Ask for price

Pigb 3'UTR Luciferase Stable Cell Line

TU216225 1.0 ml Ask for price

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

20-abx114441
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx031401-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx031401-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx236439-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) ELISA Kit

abx382225-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PIGB sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1646805 3 x 1.0 ug
EUR 376

Pigb sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4762905 3 x 1.0 ug
EUR 376

PMM3

Product not found