Vector sequences

PVT22055 pLVshRNA-EGFP(2A)Puro-CLDN14-shRNA3 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-CLDN14-shRNA3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-CLDN14-shRNA3 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a CLDN14 gene in the plasmid vector map.
PVT22056 pCDH-CMV-Akaluc-EF1-Hygro Gentaur supplies 2ug of lyophilized CDH-CMV-Akaluc-EF1-Hygro Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDH-CMV-Akaluc-EF1-Hygro plasmid. The pCDH promotor is combined with a CMV vector sequence and a Akaluc gene in the plasmid vector map.
PVT22057 pCDNA3.1-FGF14-AS2 Gentaur supplies 2ug of lyophilized CDNA3.1-FGF14-AS2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-FGF14-AS2 plasmid. The pCDNA3.1 promotor is combined with a FGF14 vector sequence and a AS2 gene in the plasmid vector map.
PVT22058 pCMV-SPORT6-Acaa2-m Gentaur supplies 2ug of lyophilized CMV-SPORT6-Acaa2-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-Acaa2-m plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a Acaa2 gene in the plasmid vector map.
PVT22059 pCR-BluntII-TOPO-FUT11 Gentaur supplies 2ug of lyophilized CR-BluntII-TOPO-FUT11 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR-BluntII-TOPO-FUT11 plasmid. The pCR promotor is combined with a BluntII vector sequence and a TOPO gene in the plasmid vector map.
PVT22060 pCDNA3.1-Atf5-m Gentaur supplies 2ug of lyophilized CDNA3.1-Atf5-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-Atf5-m plasmid. The pCDNA3.1 promotor is combined with a Atf5 vector sequence and a m gene in the plasmid vector map.
PVT22061 pCMV-SPORT6-SRP14 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SRP14 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SRP14 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SRP14 gene in the plasmid vector map.
PVT22062 pYX-Asc-Lix1-m Gentaur supplies 2ug of lyophilized YX-Asc-Lix1-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pYX-Asc-Lix1-m plasmid. The pYX promotor is combined with a Asc vector sequence and a Lix1 gene in the plasmid vector map.
PVT22063 pCMV-SPORT6-Trf-m Gentaur supplies 2ug of lyophilized CMV-SPORT6-Trf-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-Trf-m plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a Trf gene in the plasmid vector map.
PVT22064 pCR4-TOPO-PMS2 Gentaur supplies 2ug of lyophilized CR4-TOPO-PMS2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-PMS2 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a PMS2 gene in the plasmid vector map.
PVT22065 pYX-Asc-Ift122-m Gentaur supplies 2ug of lyophilized YX-Asc-Ift122-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pYX-Asc-Ift122-m plasmid. The pYX promotor is combined with a Asc vector sequence and a Ift122 gene in the plasmid vector map.
PVT22066 pSPORT1-Thbs2-m Gentaur supplies 2ug of lyophilized SPORT1-Thbs2-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pSPORT1-Thbs2-m plasmid. The pSPORT1 promotor is combined with a Thbs2 vector sequence and a m gene in the plasmid vector map.
PVT22067 pCR-BluntII-TOPO-Kcna4-m Gentaur supplies 2ug of lyophilized CR-BluntII-TOPO-Kcna4-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR-BluntII-TOPO-Kcna4-m plasmid. The pCR promotor is combined with a BluntII vector sequence and a TOPO gene in the plasmid vector map.
PVT22068 pCMV3-INSM1 Gentaur supplies 2ug of lyophilized CMV3-INSM1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV3-INSM1 plasmid. The pCMV3 promotor is combined with a INSM1 vector sequence and a  gene in the plasmid vector map.
PVT22069 pOTB7-PTDSS2 Gentaur supplies 2ug of lyophilized OTB7-PTDSS2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-PTDSS2 plasmid. The pOTB7 promotor is combined with a PTDSS2 vector sequence and a  gene in the plasmid vector map.
PVT22070 pCR-BluntII-TOPO-Tert-m Gentaur supplies 2ug of lyophilized CR-BluntII-TOPO-Tert-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR-BluntII-TOPO-Tert-m plasmid. The pCR promotor is combined with a BluntII vector sequence and a TOPO gene in the plasmid vector map.
PVT22071 pDNR-LIB-AGGF1 Gentaur supplies 2ug of lyophilized DNR-LIB-AGGF1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-LIB-AGGF1 plasmid. The pDNR promotor is combined with a LIB vector sequence and a AGGF1 gene in the plasmid vector map.
PVT22072 pEGFP-LRP5-Twinstrep Gentaur supplies 2ug of lyophilized EGFP-LRP5-Twinstre Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEGFP-LRP5-Twinstrep plasmid. The pEGFP promotor is combined with a LRP5 vector sequence and a Twinstrep gene in the plasmid vector map.
PVT22073 pEnCMV-Kif2a-m-1-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-Kif2a-m-1-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-Kif2a-m-1-3×FLAG plasmid. The pEnCMV promotor is combined with a Kif2a vector sequence and a m gene in the plasmid vector map.
PVT22074 pOTB7-CBX4 Gentaur supplies 2ug of lyophilized OTB7-CBX4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-CBX4 plasmid. The pOTB7 promotor is combined with a CBX4 vector sequence and a  gene in the plasmid vector map.
PVT22075 pGH-NCL Gentaur supplies 2ug of lyophilized GH-NCL Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pGH-NCL plasmid. The pGH promotor is combined with a NCL vector sequence and a  gene in the plasmid vector map.
PVT22076 pECMV-Opa1-m-FLAG Gentaur supplies 2ug of lyophilized ECMV-O Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-Opa1-m-FLAG plasmid. The pECMV promotor is combined with a Opa1 vector sequence and a m gene in the plasmid vector map.
PVT22077 pCR-BluntII-TOPO-SLC26A5 Gentaur supplies 2ug of lyophilized CR-BluntII-TOPO-SLC26A5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR-BluntII-TOPO-SLC26A5 plasmid. The pCR promotor is combined with a BluntII vector sequence and a TOPO gene in the plasmid vector map.
PVT22078 Cas9 sgRNA vector Gentaur supplies 2ug of lyophilized  Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the Cas9 sgRNA vector plasmid. The Cas9 sgRNA vector promotor is combined with a  vector sequence and a  gene in the plasmid vector map.
PVT22079 pCMV-SPORT6-LGR6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LGR6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LGR6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LGR6 gene in the plasmid vector map.
PVT22080 PL6-CS-WR Gentaur supplies 2ug of lyophilized  Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the PL6-CS-WR plasmid. The PL6 promotor is combined with a CS vector sequence and a WR gene in the plasmid vector map.
PVT22081 pAAV2/2 Gentaur supplies 2ug of lyophilized AAV2/2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pAAV2/2 plasmid. The pAAV2/2 promotor is combined with a  vector sequence and a  gene in the plasmid vector map.
PVT22082 pUF1-dCas9-GCN5 Gentaur supplies 2ug of lyophilized UF1-dCas9-GCN5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pUF1-dCas9-GCN5 plasmid. The pUF1 promotor is combined with a dCas9 vector sequence and a GCN5 gene in the plasmid vector map.
PVT22083 pUCmini-iCAP-PHP.eB Gentaur supplies 2ug of lyophilized UCmini-iCAP-PHP.eB Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pUCmini-iCAP-PHP.eB plasmid. The pUCmini promotor is combined with a iCAP vector sequence and a PHP.eB gene in the plasmid vector map.
PVT22084 pAAV2/9n Gentaur supplies 2ug of lyophilized AAV2/9n Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pAAV2/9n plasmid. The pAAV2/9n promotor is combined with a  vector sequence and a  gene in the plasmid vector map.
PVT22085 pCLBW cox8 EGFP mCherry Gentaur supplies 2ug of lyophilized CLBW cox8 EGFP mCherry Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCLBW cox8 EGFP mCherry plasmid. The pCLBW cox8 EGFP mCherry promotor is combined with a  vector sequence and a  gene in the plasmid vector map.
PVT22086 GOMO-GFP Gentaur supplies 2ug of lyophilized  Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the GOMO-GFP plasmid. The GOMO promotor is combined with a GFP vector sequence and a  gene in the plasmid vector map.
PVT22087 pEnCMV-LGR5-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-LGR5-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-LGR5-3×FLAG plasmid. The pEnCMV promotor is combined with a LGR5 vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22088 pEGFP-PRKN Gentaur supplies 2ug of lyophilized EGFP-PRKN Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEGFP-PRKN plasmid. The pEGFP promotor is combined with a PRKN vector sequence and a  gene in the plasmid vector map.
PVT22089 pCDNA3.0-3×FLAG-EGFP Gentaur supplies 2ug of lyophilized CDNA3.0-3×FLAG-EGFP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.0-3×FLAG-EGFP plasmid. The pCDNA3.0 promotor is combined with a 3×FLAG vector sequence and a EGFP gene in the plasmid vector map.
PVT22090 pET32a-Runx2-r Gentaur supplies 2ug of lyophilized ET32a-Runx2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pET32a-Runx2-r plasmid. The pET32a promotor is combined with a Runx2 vector sequence and a r gene in the plasmid vector map.
PVT22091 pCDNA3.1-FLAG-TFRC-p Gentaur supplies 2ug of lyophilized CDNA3.1-FLAG-TFRC- Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-FLAG-TFRC-p plasmid. The pCDNA3.1 promotor is combined with a FLAG vector sequence and a TFRC gene in the plasmid vector map.
PVT22092 pCR4-TOPO-PRPSAP2-2 Gentaur supplies 2ug of lyophilized CR4-TOPO-PRPSAP2-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-PRPSAP2-2 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a PRPSAP2 gene in the plasmid vector map.
PVT22093 pCR-BluntII-TOPO-Mib1-m Gentaur supplies 2ug of lyophilized CR-BluntII-TOPO-Mib1-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR-BluntII-TOPO-Mib1-m plasmid. The pCR promotor is combined with a BluntII vector sequence and a TOPO gene in the plasmid vector map.
PVT22094 pSEAP2-Control Gentaur supplies 2ug of lyophilized SEAP2-Control Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pSEAP2-Control plasmid. The pSEAP2 promotor is combined with a Control vector sequence and a  gene in the plasmid vector map.
PVT22095 pLVshRNA-EGFP(2A)Puro-PLAUR-shRNA1 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-PLAUR-shRNA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-PLAUR-shRNA1 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a PLAUR gene in the plasmid vector map.
PVT22096 pCMV-MCS-2 Gentaur supplies 2ug of lyophilized CMV-MCS-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-MCS-2 plasmid. The pCMV promotor is combined with a MCS vector sequence and a 2 gene in the plasmid vector map.
PVT22097 pLVshRNA-EGFP(2A)Puro-CAV1-control Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-CAV1-control Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-CAV1-control plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a CAV1 gene in the plasmid vector map.
PVT22098 pLVshRNA-EGFP(2A)Puro-CAV1-shRNA3 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-CAV1-shRNA3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-CAV1-shRNA3 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a CAV1 gene in the plasmid vector map.
PVT22099 pLVshRNA-EGFP(2A)Puro-CAV1-shRNA1 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-CAV1-shRNA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-CAV1-shRNA1 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a CAV1 gene in the plasmid vector map.
PVT22100 pLVshRNA-EGFP(2A)Puro-CAV1-shRNA2 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-CAV1-shRNA2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-CAV1-shRNA2 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a CAV1 gene in the plasmid vector map.
PVT22101 pEnCMV-EGFR G719S-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-EGFR G719S-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-EGFR G719S-3×FLAG plasmid. The pEnCMV promotor is combined with a EGFR G719S vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22102 pCMV-SPORT6-PARVB Gentaur supplies 2ug of lyophilized CMV-SPORT6-PARVB Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PARVB plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PARVB gene in the plasmid vector map.
PVT22103 pCMV-SPORT6.ccdb-Rnf138-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Rnf138-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Rnf138-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Rnf138 gene in the plasmid vector map.
PVT22104 pAAV-hSyn-EGFP Gentaur supplies 2ug of lyophilized AAV-hSyn-EGFP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pAAV-hSyn-EGFP plasmid. The pAAV promotor is combined with a hSyn vector sequence and a EGFP gene in the plasmid vector map.
PVT22105 pCR4-TOPO-ZNF367 Gentaur supplies 2ug of lyophilized CR4-TOPO-ZNF367 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-ZNF367 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a ZNF367 gene in the plasmid vector map.
PVT22106 pCR4-TOPO-IL31 Gentaur supplies 2ug of lyophilized CR4-TOPO-IL31 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-IL31 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a IL31 gene in the plasmid vector map.
PVT22107 pCDH-CMV-VIL1-EF1-CopGFP-T2A-Puro Gentaur supplies 2ug of lyophilized CDH-CMV-VIL1-EF1-Co Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDH-CMV-VIL1-EF1-CopGFP-T2A-Puro plasmid. The pCDH promotor is combined with a CMV vector sequence and a VIL1 gene in the plasmid vector map.
PVT22108 pBluescriptR-ENPP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ENPP1 plasmid. The pBluescriptR promotor is combined with a ENPP1 vector sequence and a  gene in the plasmid vector map.
PVT22109 pOTB7-HSPA5 Gentaur supplies 2ug of lyophilized OTB7-HSPA5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-HSPA5 plasmid. The pOTB7 promotor is combined with a HSPA5 vector sequence and a  gene in the plasmid vector map.
PVT22110 pST1374-GCN4-D10A Gentaur supplies 2ug of lyophilized ST1374-GCN4-D10A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pST1374-GCN4-D10A plasmid. The pST1374 promotor is combined with a GCN4 vector sequence and a D10A gene in the plasmid vector map.
PVT22111 pCMV-SPORT6-SHFL Gentaur supplies 2ug of lyophilized CMV-SPORT6-SHFL Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SHFL plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SHFL gene in the plasmid vector map.
PVT22112 pT7T3D-PacI-Hlx-m Gentaur supplies 2ug of lyophilized T7T3D-PacI-Hlx-m Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pT7T3D-PacI-Hlx-m plasmid. The pT7T3D promotor is combined with a PacI vector sequence and a Hlx gene in the plasmid vector map.
PVT22113 pCR-BluntII-TOPO-SLC6A5 Gentaur supplies 2ug of lyophilized CR-BluntII-TOPO-SLC6A5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR-BluntII-TOPO-SLC6A5 plasmid. The pCR promotor is combined with a BluntII vector sequence and a TOPO gene in the plasmid vector map.
PVT22114 pECMV-Fbxw7-m-Myc Gentaur supplies 2ug of lyophilized ECMV-Fbxw7-m-Myc Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-Fbxw7-m-Myc plasmid. The pECMV promotor is combined with a Fbxw7 vector sequence and a m gene in the plasmid vector map.
PVT22115 pEnCMV-BRAF V600E-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-BRAF V600E-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-BRAF V600E-3×FLAG plasmid. The pEnCMV promotor is combined with a BRAF V600E vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22116 pEGFP-PLAUR Gentaur supplies 2ug of lyophilized EGFP-PLAUR Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEGFP-PLAUR plasmid. The pEGFP promotor is combined with a PLAUR vector sequence and a  gene in the plasmid vector map.
PVT22117 pCDNA3.1-HA-BCAS3 Gentaur supplies 2ug of lyophilized CDNA3.1-HA-BCAS3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-HA-BCAS3 plasmid. The pCDNA3.1 promotor is combined with a HA vector sequence and a BCAS3 gene in the plasmid vector map.
PVT22118 pCDNA3.1-HA-MDM2 Gentaur supplies 2ug of lyophilized CDNA3.1-HA-MDM2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-HA-MDM2 plasmid. The pCDNA3.1 promotor is combined with a HA vector sequence and a MDM2 gene in the plasmid vector map.
PVT22119 pECMV-WAC-3×FLAG Gentaur supplies 2ug of lyophilized ECMV-WAC-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-WAC-3×FLAG plasmid. The pECMV promotor is combined with a WAC vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22120 pECMV-Ing4-m-3×FLAG Gentaur supplies 2ug of lyophilized ECMV-Ing4-m-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-Ing4-m-3×FLAG plasmid. The pECMV promotor is combined with a Ing4 vector sequence and a m gene in the plasmid vector map.
PVT22121 pEnCMV-KRAS-G13D-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-KRAS-G13D-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-KRAS-G13D-3×FLAG plasmid. The pEnCMV promotor is combined with a KRAS vector sequence and a G13D gene in the plasmid vector map.
PVT22122 pEnCMV-KRAS-G12D-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-KRAS-G12D-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-KRAS-G12D-3×FLAG plasmid. The pEnCMV promotor is combined with a KRAS vector sequence and a G12D gene in the plasmid vector map.
PVT22123 pLVshRNA-EGFP(2A)Puro-PLAUR-shRNA2 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-PLAUR-shRNA2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-PLAUR-shRNA2 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a PLAUR gene in the plasmid vector map.
PVT22124 pLVshRNA-EGFP(2A)Puro-PLAUR-shRNA3 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-PLAUR-shRNA3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-PLAUR-shRNA3 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a PLAUR gene in the plasmid vector map.
PVT22125 pCMV-SPORT6-SBDS Gentaur supplies 2ug of lyophilized CMV-SPORT6-SBDS Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SBDS plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SBDS gene in the plasmid vector map.
PVT22126 pCMV-SPORT6-ZNF761 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF761 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF761 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF761 gene in the plasmid vector map.
PVT22127 pLVshRNA-EGFP(2A)Puro-CLDN14-shRNA2 Gentaur supplies 2ug of lyophilized LVshRNA-EGFP(2A)Puro-CLDN14-shRNA2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVshRNA-EGFP(2A)Puro-CLDN14-shRNA2 plasmid. The pLVshRNA promotor is combined with a EGFP(2A)Puro vector sequence and a CLDN14 gene in the plasmid vector map.
PVT22128 pLVX-FAM217B-FLAG-Puro Gentaur supplies 2ug of lyophilized LVX-FAM217B-FLAG-Puro Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVX-FAM217B-FLAG-Puro plasmid. The pLVX promotor is combined with a FAM217B vector sequence and a FLAG gene in the plasmid vector map.
PVT22129 pLVX-IL1F10-FLAG-Puro Gentaur supplies 2ug of lyophilized LVX-IL1F10-FLAG-Puro Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVX-IL1F10-FLAG-Puro plasmid. The pLVX promotor is combined with a IL1F10 vector sequence and a FLAG gene in the plasmid vector map.
PVT22130 pECMV-3×FLAG-Nr2f2-p Gentaur supplies 2ug of lyophilized ECMV-3×FLAG-Nr2f2- Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-3×FLAG-Nr2f2-p plasmid. The pECMV promotor is combined with a 3×FLAG vector sequence and a Nr2f2 gene in the plasmid vector map.
PVT22131 pLVX-TAFA2-FLAG-Puro Gentaur supplies 2ug of lyophilized LVX-TAFA2-FLAG-Puro Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVX-TAFA2-FLAG-Puro plasmid. The pLVX promotor is combined with a TAFA2 vector sequence and a FLAG gene in the plasmid vector map.
PVT22132 pCS2-AHR Gentaur supplies 2ug of lyophilized CS2-AHR Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCS2-AHR plasmid. The pCS2 promotor is combined with a AHR vector sequence and a  gene in the plasmid vector map.
PVT22133 pEnCMV-Hcrtr1-r-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-Hcrtr1-r-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-Hcrtr1-r-3×FLAG plasmid. The pEnCMV promotor is combined with a Hcrtr1 vector sequence and a r gene in the plasmid vector map.
PVT22134 pEnCMV-DTX4-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-DTX4-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-DTX4-3×FLAG plasmid. The pEnCMV promotor is combined with a DTX4 vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22135 pCDNA3.1-HA-HPV18-E5 Gentaur supplies 2ug of lyophilized CDNA3.1-HA-HPV18-E5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-HA-HPV18-E5 plasmid. The pCDNA3.1 promotor is combined with a HA vector sequence and a HPV18 gene in the plasmid vector map.
PVT22136 pDC316-Opa1-m Gentaur supplies 2ug of lyophilized DC316-O Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDC316-Opa1-m plasmid. The pDC316 promotor is combined with a Opa1 vector sequence and a m gene in the plasmid vector map.
PVT22137 pMG36e-ALDH Gentaur supplies 2ug of lyophilized MG36e-ALDH Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pMG36e-ALDH plasmid. The pMG36e promotor is combined with a ALDH vector sequence and a  gene in the plasmid vector map.
PVT22138 pCMV3-PLK5 Gentaur supplies 2ug of lyophilized CMV3-PLK5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV3-PLK5 plasmid. The pCMV3 promotor is combined with a PLK5 vector sequence and a  gene in the plasmid vector map.
PVT22139 pLVX-IL37-FLAG-Puro Gentaur supplies 2ug of lyophilized LVX-IL37-FLAG-Puro Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVX-IL37-FLAG-Puro plasmid. The pLVX promotor is combined with a IL37 vector sequence and a FLAG gene in the plasmid vector map.
PVT22140 pCDNA3.1-USP7 Gentaur supplies 2ug of lyophilized CDNA3.1-USP7 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-USP7 plasmid. The pCDNA3.1 promotor is combined with a USP7 vector sequence and a  gene in the plasmid vector map.
PVT22141 pEnCMV-MCS-Myc Gentaur supplies 2ug of lyophilized EnCMV-MCS-Myc Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-MCS-Myc plasmid. The pEnCMV promotor is combined with a MCS vector sequence and a Myc gene in the plasmid vector map.
PVT22142 pEnCMV-EGFR S768I-3×FLAG Gentaur supplies 2ug of lyophilized EnCMV-EGFR S768I-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pEnCMV-EGFR S768I-3×FLAG plasmid. The pEnCMV promotor is combined with a EGFR S768I vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22143 pET28a-MAP3K5(659-951aa) Gentaur supplies 2ug of lyophilized ET28a-MAP3K5(659-951aa) Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pET28a-MAP3K5(659-951aa) plasmid. The pET28a promotor is combined with a MAP3K5(659 vector sequence and a 951aa) gene in the plasmid vector map.
PVT22144 pOTB7-PPM1G Gentaur supplies 2ug of lyophilized OTB7-PPM1G Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-PPM1G plasmid. The pOTB7 promotor is combined with a PPM1G vector sequence and a  gene in the plasmid vector map.
PVT22145 pOTB7-TNIP1 Gentaur supplies 2ug of lyophilized OTB7-TNIP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-TNIP1 plasmid. The pOTB7 promotor is combined with a TNIP1 vector sequence and a  gene in the plasmid vector map.
PVT22146 pOTB7-DDX3X Gentaur supplies 2ug of lyophilized OTB7-DDX3X Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-DDX3X plasmid. The pOTB7 promotor is combined with a DDX3X vector sequence and a  gene in the plasmid vector map.
PVT22147 pCR4-TOPO-MAPK4-2 Gentaur supplies 2ug of lyophilized CR4-TOPO-MAPK4-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-MAPK4-2 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a MAPK4 gene in the plasmid vector map.
PVT22148 pCR4-TOPO-SEC31A Gentaur supplies 2ug of lyophilized CR4-TOPO-SEC31A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-SEC31A plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a SEC31A gene in the plasmid vector map.
PVT22149 pCR4-TOPO-KRI1 Gentaur supplies 2ug of lyophilized CR4-TOPO-KRI1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-KRI1 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a KRI1 gene in the plasmid vector map.
PVT22150 pCR4-TOPO-SNX27 Gentaur supplies 2ug of lyophilized CR4-TOPO-SNX27 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-SNX27 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a SNX27 gene in the plasmid vector map.
PVT22151 pOTB7-STX16 Gentaur supplies 2ug of lyophilized OTB7-STX16 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-STX16 plasmid. The pOTB7 promotor is combined with a STX16 vector sequence and a  gene in the plasmid vector map.
PVT22152 pBluescriptR-TCTN3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TCTN3 plasmid. The pBluescriptR promotor is combined with a TCTN3 vector sequence and a  gene in the plasmid vector map.
PVT22153 pGEM-4Z Gentaur supplies 2ug of lyophilized GEM-4Z Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pGEM-4Z plasmid. The pGEM promotor is combined with a 4Z vector sequence and a  gene in the plasmid vector map.
PVT22154 pYES-DEST52 Gentaur supplies 2ug of lyophilized YES-DEST52 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pYES-DEST52 plasmid. The pYES promotor is combined with a DEST52 vector sequence and a  gene in the plasmid vector map.
PVT22155 PiggyBac Dual promoter-CAG Gentaur supplies 2ug of lyophilized romoter-CAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the PiggyBac Dual promoter-CAG plasmid. The PiggyBac Dual promoter promotor is combined with a CAG vector sequence and a  gene in the plasmid vector map.
PVT22156 pUF1-dCas9-Sir2a Gentaur supplies 2ug of lyophilized UF1-dCas9-Sir2a Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pUF1-dCas9-Sir2a plasmid. The pUF1 promotor is combined with a dCas9 vector sequence and a Sir2a gene in the plasmid vector map.
PVT22157 pCMV-Myc-Mito Gentaur supplies 2ug of lyophilized CMV-Myc-Mito Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-Myc-Mito plasmid. The pCMV promotor is combined with a Myc vector sequence and a Mito gene in the plasmid vector map.
PVT22158 pLVX-USP25-Puro Gentaur supplies 2ug of lyophilized LVX-USP25-Puro Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVX-USP25-Puro plasmid. The pLVX promotor is combined with a USP25 vector sequence and a Puro gene in the plasmid vector map.
PVT22159 pCDNA3.4-TRPM2 Gentaur supplies 2ug of lyophilized CDNA3.4-TRPM2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.4-TRPM2 plasmid. The pCDNA3.4 promotor is combined with a TRPM2 vector sequence and a  gene in the plasmid vector map.
PVT22160 pECMV-Map3k2-m-FLAG-S153E Gentaur supplies 2ug of lyophilized ECMV-Ma Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-Map3k2-m-FLAG-S153E plasmid. The pECMV promotor is combined with a Map3k2 vector sequence and a m gene in the plasmid vector map.
PVT22161 pSEAP-Basic Gentaur supplies 2ug of lyophilized SEAP-Basic Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pSEAP-Basic plasmid. The pSEAP promotor is combined with a Basic vector sequence and a  gene in the plasmid vector map.
PVT22162 pCMV-SPORT6-RPS3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPS3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPS3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPS3 gene in the plasmid vector map.
PVT22163 pCMV-SPORT6-DCK( Gentaur supplies 2ug of lyophilized CMV-SPORT6-DCK( Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DCK( plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DCK( gene in the plasmid vector map.
PVT22164 pCMV-SPORT6-PPP2R5A( Gentaur supplies 2ug of lyophilized CMV-SPORT6-PPP2R5A( Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PPP2R5A( plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PPP2R5A( gene in the plasmid vector map.
PVT22165 pCMV-SPORT6-KIAA1529-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-KIAA1529-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KIAA1529-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KIAA1529 gene in the plasmid vector map.
PVT22166 pBluescriptR-MORC2-LOC104003744 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MORC2-LOC104003744 plasmid. The pBluescriptR promotor is combined with a MORC2 vector sequence and a LOC104003744 gene in the plasmid vector map.
PVT22167 pBluescriptR-RNF212 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RNF212 plasmid. The pBluescriptR promotor is combined with a RNF212 vector sequence and a  gene in the plasmid vector map.
PVT22168 pBluescriptR-SREK1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SREK1 plasmid. The pBluescriptR promotor is combined with a SREK1 vector sequence and a  gene in the plasmid vector map.
PVT22169 pDNR-Dual-GPR63 Gentaur supplies 2ug of lyophilized DNR-Dual-GPR63 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-GPR63 plasmid. The pDNR promotor is combined with a Dual vector sequence and a GPR63 gene in the plasmid vector map.
PVT22170 pPCR-Script Amp SK(+)-ZNF415 Gentaur supplies 2ug of lyophilized PCR-Scri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pPCR-Script Amp SK(+)-ZNF415 plasmid. The pPCR promotor is combined with a Script Amp SK(+) vector sequence and a ZNF415 gene in the plasmid vector map.
PVT22171 pDNR-Dual-NPBWR2 Gentaur supplies 2ug of lyophilized DNR-Dual-NPBWR2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-NPBWR2 plasmid. The pDNR promotor is combined with a Dual vector sequence and a NPBWR2 gene in the plasmid vector map.
PVT22172 pDNR-Dual-B3GNT3 Gentaur supplies 2ug of lyophilized DNR-Dual-B3GNT3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-B3GNT3 plasmid. The pDNR promotor is combined with a Dual vector sequence and a B3GNT3 gene in the plasmid vector map.
PVT22173 pDNR-Dual-B3GNT3-2 Gentaur supplies 2ug of lyophilized DNR-Dual-B3GNT3-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-B3GNT3-2 plasmid. The pDNR promotor is combined with a Dual vector sequence and a B3GNT3 gene in the plasmid vector map.
PVT22174 pDNR-Dual-C5AR2 Gentaur supplies 2ug of lyophilized DNR-Dual-C5AR2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-C5AR2 plasmid. The pDNR promotor is combined with a Dual vector sequence and a C5AR2 gene in the plasmid vector map.
PVT22175 pDNR-Dual-ERVMER34-1 Gentaur supplies 2ug of lyophilized DNR-Dual-ERVMER34-1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-ERVMER34-1 plasmid. The pDNR promotor is combined with a Dual vector sequence and a ERVMER34 gene in the plasmid vector map.
PVT22176 pDNR-Dual-GPR75 Gentaur supplies 2ug of lyophilized DNR-Dual-GPR75 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-GPR75 plasmid. The pDNR promotor is combined with a Dual vector sequence and a GPR75 gene in the plasmid vector map.
PVT22177 pPCR-Script Amp SK(+)-PGLYRP3 Gentaur supplies 2ug of lyophilized PCR-Scri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pPCR-Script Amp SK(+)-PGLYRP3 plasmid. The pPCR promotor is combined with a Script Amp SK(+) vector sequence and a PGLYRP3 gene in the plasmid vector map.
PVT22178 pDNR-Dual-GPR75-2 Gentaur supplies 2ug of lyophilized DNR-Dual-GPR75-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-GPR75-2 plasmid. The pDNR promotor is combined with a Dual vector sequence and a GPR75 gene in the plasmid vector map.
PVT22179 pDNR-Dual-GPR21-2 Gentaur supplies 2ug of lyophilized DNR-Dual-GPR21-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-GPR21-2 plasmid. The pDNR promotor is combined with a Dual vector sequence and a GPR21 gene in the plasmid vector map.
PVT22180 pDNR-Dual-DAB1-2 Gentaur supplies 2ug of lyophilized DNR-Dual-DAB1-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-DAB1-2 plasmid. The pDNR promotor is combined with a Dual vector sequence and a DAB1 gene in the plasmid vector map.
PVT22181 pPCR-Script Amp SK(+)-CD200R1 Gentaur supplies 2ug of lyophilized PCR-Scri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pPCR-Script Amp SK(+)-CD200R1 plasmid. The pPCR promotor is combined with a Script Amp SK(+) vector sequence and a CD200R1 gene in the plasmid vector map.
PVT22182 pCMV-SPORT6.ccdb-Adm-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Adm-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Adm-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Adm gene in the plasmid vector map.
PVT22183 pCMV-SPORT6-CREB3L2-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CREB3L2-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CREB3L2-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CREB3L2 gene in the plasmid vector map.
PVT22184 pPCR-Script Amp SK(+)-CCL18 Gentaur supplies 2ug of lyophilized PCR-Scri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pPCR-Script Amp SK(+)-CCL18 plasmid. The pPCR promotor is combined with a Script Amp SK(+) vector sequence and a CCL18 gene in the plasmid vector map.
PVT22185 pCMV-SPORT6.ccdb-Fut4-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Fut4-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Fut4-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Fut4 gene in the plasmid vector map.
PVT22186 pPCR-Script Amp SK(+)-IFNA6 Gentaur supplies 2ug of lyophilized PCR-Scri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pPCR-Script Amp SK(+)-IFNA6 plasmid. The pPCR promotor is combined with a Script Amp SK(+) vector sequence and a IFNA6 gene in the plasmid vector map.
PVT22187 pDNR-Dual-IL4-2 Gentaur supplies 2ug of lyophilized DNR-Dual-IL4-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-IL4-2 plasmid. The pDNR promotor is combined with a Dual vector sequence and a IL4 gene in the plasmid vector map.
PVT22188 pDNR-Dual-IL23A Gentaur supplies 2ug of lyophilized DNR-Dual-IL23A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-IL23A plasmid. The pDNR promotor is combined with a Dual vector sequence and a IL23A gene in the plasmid vector map.
PVT22189 pCR4-TOPO-GLDN Gentaur supplies 2ug of lyophilized CR4-TOPO-GLDN Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-GLDN plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a GLDN gene in the plasmid vector map.
PVT22190 pCDNA3.1-SCN2A-3×FLAG Gentaur supplies 2ug of lyophilized CDNA3.1-SCN2A-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-SCN2A-3×FLAG plasmid. The pCDNA3.1 promotor is combined with a SCN2A vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22191 pLVX-TSHR-Myc-FLAG-Puro Gentaur supplies 2ug of lyophilized LVX-TSHR-Myc-FLAG-Puro Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pLVX-TSHR-Myc-FLAG-Puro plasmid. The pLVX promotor is combined with a TSHR vector sequence and a Myc gene in the plasmid vector map.
PVT22192 pMIGR1-IRES2-VN173 Gentaur supplies 2ug of lyophilized MIGR1-IRES2-VN173 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pMIGR1-IRES2-VN173 plasmid. The pMIGR1 promotor is combined with a IRES2 vector sequence and a VN173 gene in the plasmid vector map.
PVT22193 pCDNA3.1-CORO6-3×FLAG Gentaur supplies 2ug of lyophilized CDNA3.1-CORO6-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-CORO6-3×FLAG plasmid. The pCDNA3.1 promotor is combined with a CORO6 vector sequence and a 3×FLAG gene in the plasmid vector map.
PVT22194 pCDNA3.1-Luc Gentaur supplies 2ug of lyophilized CDNA3.1-Luc Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCDNA3.1-Luc plasmid. The pCDNA3.1 promotor is combined with a Luc vector sequence and a  gene in the plasmid vector map.
PVT22195 pCMV-tmem206-HA Gentaur supplies 2ug of lyophilized CMV-tmem206-HA Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-tmem206-HA plasmid. The pCMV promotor is combined with a tmem206 vector sequence and a HA gene in the plasmid vector map.
PVT22196 pCR4-TOPO-OR51B2 Gentaur supplies 2ug of lyophilized CR4-TOPO-OR51B2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-OR51B2 plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a OR51B2 gene in the plasmid vector map.
PVT22197 pCMV-pacc1-HA Gentaur supplies 2ug of lyophilized CMV- Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-pacc1-HA plasmid. The pCMV promotor is combined with a pacc1 vector sequence and a HA gene in the plasmid vector map.
PVT22198 pECMV-Hcrtr2-r-3×FLAG Gentaur supplies 2ug of lyophilized ECMV-Hcrtr2-r-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-Hcrtr2-r-3×FLAG plasmid. The pECMV promotor is combined with a Hcrtr2 vector sequence and a r gene in the plasmid vector map.
PVT22199 p3×FLAG-CMV-TBK1-b-7.1 Gentaur supplies 2ug of lyophilized 3×FLAG-CMV-TBK1-b-7.1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the p3×FLAG-CMV-TBK1-b-7.1 plasmid. The p3×FLAG promotor is combined with a CMV vector sequence and a TBK1 gene in the plasmid vector map.
PVT22200 pDNR-Dual-GPR45 Gentaur supplies 2ug of lyophilized DNR-Dual-GPR45 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pDNR-Dual-GPR45 plasmid. The pDNR promotor is combined with a Dual vector sequence and a GPR45 gene in the plasmid vector map.
PVT22201 pECMV-Ift140-m-3×FLAG Gentaur supplies 2ug of lyophilized ECMV-Ift140-m-3×FLAG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pECMV-Ift140-m-3×FLAG plasmid. The pECMV promotor is combined with a Ift140 vector sequence and a m gene in the plasmid vector map.
PVT22202 pUC57-EPRS1 Gentaur supplies 2ug of lyophilized UC57-EPRS1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pUC57-EPRS1 plasmid. The pUC57 promotor is combined with a EPRS1 vector sequence and a  gene in the plasmid vector map.
PVT22203 pCR4-TOPO-PRLHR Gentaur supplies 2ug of lyophilized CR4-TOPO-PRLHR Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCR4-TOPO-PRLHR plasmid. The pCR4 promotor is combined with a TOPO vector sequence and a PRLHR gene in the plasmid vector map.
PVT22204 pMG36e-hADH7 Gentaur supplies 2ug of lyophilized MG36e-hADH7 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pMG36e-hADH7 plasmid. The pMG36e promotor is combined with a hADH7 vector sequence and a  gene in the plasmid vector map.
PVT22205 pHAGE-CMV-NCL-IRES-ZsGreen1 Gentaur supplies 2ug of lyophilized HAGE-CMV-NCL-IRES-ZsGreen1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pHAGE-CMV-NCL-IRES-ZsGreen1 plasmid. The pHAGE promotor is combined with a CMV vector sequence and a NCL gene in the plasmid vector map.
PVT22206 pCMV-SPORT6.ccdb-Mterf3-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Mterf3-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Mterf3-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Mterf3 gene in the plasmid vector map.
PVT22207 pCMV-SPORT6.ccdb-Adipor1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Adi Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Adipor1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Adipor1 gene in the plasmid vector map.
PVT22208 pCMV-SPORT6.ccdb-Nbl1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Nbl1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Nbl1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Nbl1 gene in the plasmid vector map.
PVT22209 pCMV-SPORT6.ccdb-Wars-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Wars-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Wars-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Wars gene in the plasmid vector map.
PVT22210 pCMV-SPORT6.ccdb-P2ry2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-P2ry2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-P2ry2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a P2ry2 gene in the plasmid vector map.
PVT22211 pCMV-SPORT6.ccdb-Trim25-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Trim25-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Trim25-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Trim25 gene in the plasmid vector map.
PVT22212 pCMV-SPORT6.ccdb-Hdac3-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Hdac3-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Hdac3-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Hdac3 gene in the plasmid vector map.
PVT22213 pCMV-SPORT6.ccdb-Slc3a2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Slc3a2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Slc3a2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Slc3a2 gene in the plasmid vector map.
PVT22214 pCMV-SPORT6.ccdb-Pgrmc1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Pgrmc1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Pgrmc1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Pgrmc1 gene in the plasmid vector map.
PVT22215 pCMV-SPORT6.ccdb-Lamp2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Lam Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Lamp2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Lamp2 gene in the plasmid vector map.
PVT22216 pCMV-SPORT6.ccdb-Grina-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Grina-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Grina-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Grina gene in the plasmid vector map.
PVT22217 pCMV-SPORT6.ccdb-Pdk2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Pdk2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Pdk2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Pdk2 gene in the plasmid vector map.
PVT22218 pCMV-SPORT6.ccdb-Trim63-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Trim63-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Trim63-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Trim63 gene in the plasmid vector map.
PVT22219 pCMV-SPORT6.ccdb-Slc1a1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Slc1a1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Slc1a1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Slc1a1 gene in the plasmid vector map.
PVT22220 pCMV-SPORT6.ccdb-Ankrd9-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ankrd9-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ankrd9-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ankrd9 gene in the plasmid vector map.
PVT22221 pCMV-SPORT6.ccdb-Rtn3-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Rtn3-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Rtn3-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Rtn3 gene in the plasmid vector map.
PVT22222 pCMV-SPORT6.ccdb-Hspb8-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Hs Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Hspb8-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Hspb8 gene in the plasmid vector map.
PVT22223 pCMV-SPORT6.ccdb-Atp5f1a-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-At Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Atp5f1a-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Atp5f1a gene in the plasmid vector map.
PVT22224 pCMV-SPORT6.ccdb-Akr7a2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Akr7a2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Akr7a2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Akr7a2 gene in the plasmid vector map.
PVT22225 pCMV-SPORT6.ccdb-Hmox2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Hmox2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Hmox2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Hmox2 gene in the plasmid vector map.
PVT22226 pCMV-SPORT6.ccdb-Gosr2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Gosr2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Gosr2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Gosr2 gene in the plasmid vector map.
PVT22227 pCMV-SPORT6.ccdb-Khdrbs1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Khdrbs1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Khdrbs1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Khdrbs1 gene in the plasmid vector map.
PVT22228 pCMV-SPORT6.ccdb-Plpp1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Pl Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Plpp1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Plpp1 gene in the plasmid vector map.
PVT22229 pCMV-SPORT6.ccdb-Vdac3-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Vdac3-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Vdac3-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Vdac3 gene in the plasmid vector map.
PVT22230 pCMV-SPORT6.ccdb-Calr-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Calr-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Calr-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Calr gene in the plasmid vector map.
PVT22231 pCMV-SPORT6.ccdb-Pfn1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Pfn1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Pfn1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Pfn1 gene in the plasmid vector map.
PVT22232 pCMV-SPORT6.ccdb-Hmgb1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Hmgb1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Hmgb1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Hmgb1 gene in the plasmid vector map.
PVT22233 pCMV-SPORT6.ccdb-Cnn3-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Cnn3-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Cnn3-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Cnn3 gene in the plasmid vector map.
PVT22234 pCMV-SPORT6.ccdb-Atxn10-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Atxn10-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Atxn10-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Atxn10 gene in the plasmid vector map.
PVT22235 pCMV-SPORT6.ccdb-Tagln-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Tagln-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Tagln-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Tagln gene in the plasmid vector map.
PVT22236 pCMV-SPORT6.ccdb-Rnf4-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Rnf4-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Rnf4-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Rnf4 gene in the plasmid vector map.
PVT22237 pCMV-SPORT6.ccdb-Mmp7-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Mm Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Mmp7-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Mmp7 gene in the plasmid vector map.
PVT22238 pCMV-SPORT6.ccdb-Ppt2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-P Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ppt2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ppt2 gene in the plasmid vector map.
PVT22239 pCMV-SPORT6.ccdb-Ddit4-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ddit4-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ddit4-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ddit4 gene in the plasmid vector map.
PVT22240 pCMV-SPORT6.ccdb-Kpna2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-K Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Kpna2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Kpna2 gene in the plasmid vector map.
PVT22241 pCMV-SPORT6.ccdb-Serp1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ser Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Serp1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Serp1 gene in the plasmid vector map.
PVT22242 pCMV-SPORT6.ccdb-Arpc1b-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ar Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Arpc1b-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Arpc1b gene in the plasmid vector map.
PVT22243 pCMV-SPORT6.ccdb-Bet1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Bet1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Bet1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Bet1 gene in the plasmid vector map.
PVT22244 pCMV-SPORT6.ccdb-Nucb2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Nucb2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Nucb2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Nucb2 gene in the plasmid vector map.
PVT22245 pCMV-SPORT6.ccdb-Sparc-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-S Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Sparc-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Sparc gene in the plasmid vector map.
PVT22246 pCMV-SPORT6.ccdb-Lmna-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Lmna-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Lmna-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Lmna gene in the plasmid vector map.
PVT22247 pCMV-SPORT6.ccdb-Jtb-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Jtb-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Jtb-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Jtb gene in the plasmid vector map.
PVT22248 pCMV-SPORT6.ccdb-Rcbtb2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Rcbtb2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Rcbtb2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Rcbtb2 gene in the plasmid vector map.
PVT22249 pCMV-SPORT6.ccdb-Ahcy-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ahcy-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ahcy-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ahcy gene in the plasmid vector map.
PVT22250 pCMV-SPORT6.ccdb-F11r-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-F11r-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-F11r-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a F11r gene in the plasmid vector map.
PVT22251 pCMV-SPORT6.ccdb-Krt5-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Krt5-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Krt5-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Krt5 gene in the plasmid vector map.
PVT22252 pCMV-SPORT6.ccdb-Tfam-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Tfam-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Tfam-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Tfam gene in the plasmid vector map.
PVT22253 pCMV-SPORT6.ccdb-Prkab1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Prkab1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Prkab1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Prkab1 gene in the plasmid vector map.
PVT22254 pCMV-SPORT6.ccdb-Wls-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Wls-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Wls-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Wls gene in the plasmid vector map.
PVT22255 pCMV-SPORT6.ccdb-Rab4a-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Rab4a-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Rab4a-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Rab4a gene in the plasmid vector map.
PVT22256 pCMV-SPORT6.ccdb-Smn1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Smn1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Smn1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Smn1 gene in the plasmid vector map.
PVT22257 pCMV-SPORT6.ccdb-Ssr3-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ssr3-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ssr3-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ssr3 gene in the plasmid vector map.
PVT22258 pCMV-SPORT6.ccdb-Adh1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Adh1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Adh1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Adh1 gene in the plasmid vector map.
PVT22259 pCMV-SPORT6.ccdb-Crip2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Cri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Crip2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Crip2 gene in the plasmid vector map.
PVT22260 pCMV-SPORT6.ccdb-Pold4-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Pold4-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Pold4-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Pold4 gene in the plasmid vector map.
PVT22261 pCMV-SPORT6.ccdb-Eif2s2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Eif2s2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Eif2s2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Eif2s2 gene in the plasmid vector map.
PVT22262 pCMV-SPORT6.ccdb-Adrm1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Adrm1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Adrm1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Adrm1 gene in the plasmid vector map.
PVT22263 pCMV-SPORT6.ccdb-Cyp27a1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Cy Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Cyp27a1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Cyp27a1 gene in the plasmid vector map.
PVT22264 pCMV-SPORT6.ccdb-Bcl10-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Bcl10-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Bcl10-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Bcl10 gene in the plasmid vector map.
PVT22265 pCMV-SPORT6.ccdb-Plpp2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Pl Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Plpp2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Plpp2 gene in the plasmid vector map.
PVT22266 pCMV-SPORT6.ccdb-Rdh16-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Rdh16-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Rdh16-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Rdh16 gene in the plasmid vector map.
PVT22267 pCMV-SPORT6.ccdb-Scgb2a2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Scgb2a2-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Scgb2a2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Scgb2a2 gene in the plasmid vector map.
PVT22268 pCMV-SPORT6.ccdb-Ywhaq-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ywhaq-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ywhaq-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ywhaq gene in the plasmid vector map.
PVT22269 pCMV-SPORT6.ccdb-Gne-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Gne-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Gne-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Gne gene in the plasmid vector map.
PVT22270 pCMV-SPORT6.ccdb-Ak3-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ak3-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ak3-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ak3 gene in the plasmid vector map.
PVT22271 pCMV-SPORT6.ccdb-Rbbp7-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Rbb Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Rbbp7-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Rbbp7 gene in the plasmid vector map.
PVT22272 pCMV-SPORT6.ccdb-Mlycd-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Mlycd-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Mlycd-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Mlycd gene in the plasmid vector map.
PVT22273 pCMV-SPORT6.ccdb-Ptn-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ptn-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ptn-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ptn gene in the plasmid vector map.
PVT22274 pCMV-SPORT6.ccdb-Ilkap-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ilka Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ilkap-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ilkap gene in the plasmid vector map.
PVT22275 pCMV-SPORT6.ccdb-Ostf1-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-Ostf1-r Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Ostf1-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Ostf1 gene in the plasmid vector map.
PVT22276 pCMV-SPORT6.ccdb-Spint2-r Gentaur supplies 2ug of lyophilized CMV-SPORT6.ccdb-S Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6.ccdb-Spint2-r plasmid. The pCMV promotor is combined with a SPORT6.ccdb vector sequence and a Spint2 gene in the plasmid vector map.
PVT22277 pBluescriptR-COL1A1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-COL1A1 plasmid. The pBluescriptR promotor is combined with a COL1A1 vector sequence and a  gene in the plasmid vector map.
PVT22278 pBluescriptR-NLP Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NLP plasmid. The pBluescriptR promotor is combined with a NLP vector sequence and a  gene in the plasmid vector map.
PVT22279 pBluescriptR-POGLUT3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-POGLUT3 plasmid. The pBluescriptR promotor is combined with a POGLUT3 vector sequence and a  gene in the plasmid vector map.
PVT22280 pBluescriptR-ADAMTS1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ADAMTS1 plasmid. The pBluescriptR promotor is combined with a ADAMTS1 vector sequence and a  gene in the plasmid vector map.
PVT22281 pBluescriptR-BMP2K Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-BMP2K plasmid. The pBluescriptR promotor is combined with a BMP2K vector sequence and a  gene in the plasmid vector map.
PVT22282 pBluescriptR-IZUMO2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-IZUMO2 plasmid. The pBluescriptR promotor is combined with a IZUMO2 vector sequence and a  gene in the plasmid vector map.
PVT22283 pBluescriptR-AFTPH Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-AFTPH plasmid. The pBluescriptR promotor is combined with a AFTPH vector sequence and a  gene in the plasmid vector map.
PVT22284 pBluescriptR-BVES Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-BVES plasmid. The pBluescriptR promotor is combined with a BVES vector sequence and a  gene in the plasmid vector map.
PVT22285 pBluescriptR-MAFB Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MAFB plasmid. The pBluescriptR promotor is combined with a MAFB vector sequence and a  gene in the plasmid vector map.
PVT22286 pBluescriptR-WDFY1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-WDFY1 plasmid. The pBluescriptR promotor is combined with a WDFY1 vector sequence and a  gene in the plasmid vector map.
PVT22287 pBluescriptR-MFSD6L Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MFSD6L plasmid. The pBluescriptR promotor is combined with a MFSD6L vector sequence and a  gene in the plasmid vector map.
PVT22288 pBluescriptR-FSTL5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FSTL5 plasmid. The pBluescriptR promotor is combined with a FSTL5 vector sequence and a  gene in the plasmid vector map.
PVT22289 pBluescriptR-FOXG1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FOXG1 plasmid. The pBluescriptR promotor is combined with a FOXG1 vector sequence and a  gene in the plasmid vector map.
PVT22290 pBluescriptR-UBP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-UBP1 plasmid. The pBluescriptR promotor is combined with a UBP1 vector sequence and a  gene in the plasmid vector map.
PVT22291 pBluescriptR-TRIB1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TRIB1 plasmid. The pBluescriptR promotor is combined with a TRIB1 vector sequence and a  gene in the plasmid vector map.
PVT22292 pCMV-SPORT6-NPRL2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NPRL2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NPRL2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NPRL2 gene in the plasmid vector map.
PVT22293 pCMV-SPORT6-UBE2M Gentaur supplies 2ug of lyophilized CMV-SPORT6-UBE2M Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-UBE2M plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a UBE2M gene in the plasmid vector map.
PVT22294 pCMV-SPORT6-YWHAQ Gentaur supplies 2ug of lyophilized CMV-SPORT6-YWHAQ Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-YWHAQ plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a YWHAQ gene in the plasmid vector map.
PVT22295 pCMV-SPORT6-SEC14L2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SEC14L2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SEC14L2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SEC14L2 gene in the plasmid vector map.
PVT22296 pCMV-SPORT6-CRTC2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CRTC2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CRTC2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CRTC2 gene in the plasmid vector map.
PVT22297 pCMV-SPORT6-C3orf62 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C3orf62 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C3orf62 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C3orf62 gene in the plasmid vector map.
PVT22298 pCMV-SPORT6-MYOG Gentaur supplies 2ug of lyophilized CMV-SPORT6-MYOG Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MYOG plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MYOG gene in the plasmid vector map.
PVT22299 pCMV-SPORT6-TMPO Gentaur supplies 2ug of lyophilized CMV-SPORT6-TMPO Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TMPO plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TMPO gene in the plasmid vector map.
PVT22300 pCMV-SPORT6-IKBIP Gentaur supplies 2ug of lyophilized CMV-SPORT6-IKBIP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-IKBIP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a IKBIP gene in the plasmid vector map.
PVT22301 pCMV-SPORT6-PLVAP Gentaur supplies 2ug of lyophilized CMV-SPORT6-PLVAP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PLVAP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PLVAP gene in the plasmid vector map.
PVT22302 pCMV-SPORT6-GALNS Gentaur supplies 2ug of lyophilized CMV-SPORT6-GALNS Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GALNS plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GALNS gene in the plasmid vector map.
PVT22303 pCMV-SPORT6-PTPN5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PTPN5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PTPN5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PTPN5 gene in the plasmid vector map.
PVT22304 pCMV-SPORT6-MYO1B Gentaur supplies 2ug of lyophilized CMV-SPORT6-MYO1B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MYO1B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MYO1B gene in the plasmid vector map.
PVT22305 pCMV-SPORT6-CCN5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CCN5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CCN5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CCN5 gene in the plasmid vector map.
PVT22306 pCMV-SPORT6-CHAC2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CHAC2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CHAC2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CHAC2 gene in the plasmid vector map.
PVT22307 pCMV-SPORT6-DDX1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DDX1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DDX1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DDX1 gene in the plasmid vector map.
PVT22308 pCMV-SPORT6-TRMT11 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TRMT11 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TRMT11 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TRMT11 gene in the plasmid vector map.
PVT22309 pCMV-SPORT6-MEAF6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MEAF6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MEAF6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MEAF6 gene in the plasmid vector map.
PVT22310 pCMV-SPORT6-CARD8 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CARD8 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CARD8 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CARD8 gene in the plasmid vector map.
PVT22311 pCMV-SPORT6-DSN1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DSN1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DSN1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DSN1 gene in the plasmid vector map.
PVT22312 pCMV-SPORT6-RNF115 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RNF115 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RNF115 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RNF115 gene in the plasmid vector map.
PVT22313 pCMV-SPORT6-C9orf85 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C9orf85 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C9orf85 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C9orf85 gene in the plasmid vector map.
PVT22314 pCMV-SPORT6-CES3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CES3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CES3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CES3 gene in the plasmid vector map.
PVT22315 pCMV-SPORT6-LRRN4CL Gentaur supplies 2ug of lyophilized CMV-SPORT6-LRRN4CL Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LRRN4CL plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LRRN4CL gene in the plasmid vector map.
PVT22316 pCMV-SPORT6-AKNA Gentaur supplies 2ug of lyophilized CMV-SPORT6-AKNA Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-AKNA plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a AKNA gene in the plasmid vector map.
PVT22317 pCMV-SPORT6-RPAP3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPAP3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPAP3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPAP3 gene in the plasmid vector map.
PVT22318 pCMV-SPORT6-NCR1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NCR1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NCR1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NCR1 gene in the plasmid vector map.
PVT22319 pCMV-SPORT6-PPDPF Gentaur supplies 2ug of lyophilized CMV-SPORT6-PPDPF Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PPDPF plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PPDPF gene in the plasmid vector map.
PVT22320 pCMV-SPORT6-H2AC20 Gentaur supplies 2ug of lyophilized CMV-SPORT6-H2AC20 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-H2AC20 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a H2AC20 gene in the plasmid vector map.
PVT22321 pCMV-SPORT6-ANXA4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ANXA4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ANXA4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ANXA4 gene in the plasmid vector map.
PVT22322 pCMV-SPORT6-C1S Gentaur supplies 2ug of lyophilized CMV-SPORT6-C1S Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C1S plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C1S gene in the plasmid vector map.
PVT22323 pCMV-SPORT6-TBCB Gentaur supplies 2ug of lyophilized CMV-SPORT6-TBCB Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TBCB plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TBCB gene in the plasmid vector map.
PVT22324 pCMV-SPORT6-ARMCX5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARMCX5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARMCX5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARMCX5 gene in the plasmid vector map.
PVT22325 pCMV-SPORT6-BCDIN3D Gentaur supplies 2ug of lyophilized CMV-SPORT6-BCDIN3D Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-BCDIN3D plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a BCDIN3D gene in the plasmid vector map.
PVT22326 pCMV-SPORT6-FTH1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FTH1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FTH1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FTH1 gene in the plasmid vector map.
PVT22327 pCMV-SPORT6-OSBPL11 Gentaur supplies 2ug of lyophilized CMV-SPORT6-OSBPL11 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-OSBPL11 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a OSBPL11 gene in the plasmid vector map.
PVT22328 pCMV-SPORT6-DUSP15 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DUSP15 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DUSP15 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DUSP15 gene in the plasmid vector map.
PVT22329 pCMV-SPORT6-RABEP2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RABEP2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RABEP2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RABEP2 gene in the plasmid vector map.
PVT22330 pCMV-SPORT6-TUBB2B Gentaur supplies 2ug of lyophilized CMV-SPORT6-TUBB2B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TUBB2B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TUBB2B gene in the plasmid vector map.
PVT22331 pCMV-SPORT6-BOLA1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-BOLA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-BOLA1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a BOLA1 gene in the plasmid vector map.
PVT22332 pCMV-SPORT6-DNAAF4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DNAAF4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DNAAF4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DNAAF4 gene in the plasmid vector map.
PVT22333 pCMV-SPORT6-NPHP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NPHP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NPHP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NPHP1 gene in the plasmid vector map.
PVT22334 pCMV-SPORT6-LARP4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LARP4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LARP4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LARP4 gene in the plasmid vector map.
PVT22335 pCMV-SPORT6-MSRA Gentaur supplies 2ug of lyophilized CMV-SPORT6-MSRA Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MSRA plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MSRA gene in the plasmid vector map.
PVT22336 pCMV-SPORT6-SYT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SYT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SYT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SYT1 gene in the plasmid vector map.
PVT22337 pCMV-SPORT6-NADK2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NADK2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NADK2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NADK2 gene in the plasmid vector map.
PVT22338 pCMV-SPORT6-SYPL1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SYPL1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SYPL1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SYPL1 gene in the plasmid vector map.
PVT22339 pCMV-SPORT6-NALCN Gentaur supplies 2ug of lyophilized CMV-SPORT6-NALCN Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NALCN plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NALCN gene in the plasmid vector map.
PVT22340 pCMV-SPORT6-ATAD3A Gentaur supplies 2ug of lyophilized CMV-SPORT6-ATAD3A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ATAD3A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ATAD3A gene in the plasmid vector map.
PVT22341 pCMV-SPORT6-GOLPH3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GOLPH3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GOLPH3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GOLPH3 gene in the plasmid vector map.
PVT22342 pCMV-SPORT6-EVA1A Gentaur supplies 2ug of lyophilized CMV-SPORT6-EVA1A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EVA1A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EVA1A gene in the plasmid vector map.
PVT22343 pCMV-SPORT6-CUEDC1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CUEDC1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CUEDC1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CUEDC1 gene in the plasmid vector map.
PVT22344 pCMV-SPORT6-MMP14 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MMP14 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MMP14 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MMP14 gene in the plasmid vector map.
PVT22345 pCMV-SPORT6-OSMR Gentaur supplies 2ug of lyophilized CMV-SPORT6-OSMR Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-OSMR plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a OSMR gene in the plasmid vector map.
PVT22346 pCMV-SPORT6-PLA2G15 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PLA2G15 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PLA2G15 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PLA2G15 gene in the plasmid vector map.
PVT22347 pCMV-SPORT6-SIN3B Gentaur supplies 2ug of lyophilized CMV-SPORT6-SIN3B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SIN3B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SIN3B gene in the plasmid vector map.
PVT22348 pCMV-SPORT6-ZNF280D Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF280D Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF280D plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF280D gene in the plasmid vector map.
PVT22349 pCMV-SPORT6-INIP Gentaur supplies 2ug of lyophilized CMV-SPORT6-INIP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-INIP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a INIP gene in the plasmid vector map.
PVT22350 pCMV-SPORT6-PRF1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PRF1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PRF1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PRF1 gene in the plasmid vector map.
PVT22351 pCMV-SPORT6-SMARCE1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SMARCE1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SMARCE1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SMARCE1 gene in the plasmid vector map.
PVT22352 pCMV-SPORT6-PGBD3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PGBD3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PGBD3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PGBD3 gene in the plasmid vector map.
PVT22353 pCMV-SPORT6-TEX44 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TEX44 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TEX44 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TEX44 gene in the plasmid vector map.
PVT22354 pCMV-SPORT6-NPM1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NPM1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NPM1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NPM1 gene in the plasmid vector map.
PVT22355 pCMV-SPORT6-PLBD1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PLBD1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PLBD1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PLBD1 gene in the plasmid vector map.
PVT22356 pCMV-SPORT6-RPS6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPS6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPS6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPS6 gene in the plasmid vector map.
PVT22357 pCMV-SPORT6-DHX32 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DHX32 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DHX32 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DHX32 gene in the plasmid vector map.
PVT22358 pCMV-SPORT6-ABHD14B Gentaur supplies 2ug of lyophilized CMV-SPORT6-ABHD14B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ABHD14B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ABHD14B gene in the plasmid vector map.
PVT22359 pCMV-SPORT6-STOX1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-STOX1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-STOX1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a STOX1 gene in the plasmid vector map.
PVT22360 pCMV-SPORT6-MAGEA2B Gentaur supplies 2ug of lyophilized CMV-SPORT6-MAGEA2B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MAGEA2B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MAGEA2B gene in the plasmid vector map.
PVT22361 pCMV-SPORT6-GKN1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GKN1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GKN1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GKN1 gene in the plasmid vector map.
PVT22362 pCMV-SPORT6-MTFR2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MTFR2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MTFR2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MTFR2 gene in the plasmid vector map.
PVT22363 pCMV-SPORT6-SFXN4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SFXN4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SFXN4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SFXN4 gene in the plasmid vector map.
PVT22364 pCMV-SPORT6-PASK Gentaur supplies 2ug of lyophilized CMV-SPORT6-PASK Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PASK plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PASK gene in the plasmid vector map.
PVT22365 pCMV-SPORT6-SUOX Gentaur supplies 2ug of lyophilized CMV-SPORT6-SUOX Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SUOX plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SUOX gene in the plasmid vector map.
PVT22366 pCMV-SPORT6-C19orf33 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C19orf33 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C19orf33 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C19orf33 gene in the plasmid vector map.
PVT22367 pCMV-SPORT6-CREB3L2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CREB3L2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CREB3L2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CREB3L2 gene in the plasmid vector map.
PVT22368 pCMV-SPORT6-PTAFR Gentaur supplies 2ug of lyophilized CMV-SPORT6-PTAFR Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PTAFR plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PTAFR gene in the plasmid vector map.
PVT22369 pCMV-SPORT6-GSC Gentaur supplies 2ug of lyophilized CMV-SPORT6-GSC Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GSC plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GSC gene in the plasmid vector map.
PVT22370 pCMV-SPORT6-DNAAF3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DNAAF3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DNAAF3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DNAAF3 gene in the plasmid vector map.
PVT22371 pCMV-SPORT6-WDR83OS Gentaur supplies 2ug of lyophilized CMV-SPORT6-WDR83OS Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-WDR83OS plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a WDR83OS gene in the plasmid vector map.
PVT22372 pCMV-SPORT6-B4GALT4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-B4GALT4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-B4GALT4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a B4GALT4 gene in the plasmid vector map.
PVT22373 pCMV-SPORT6-FUT10 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FUT10 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FUT10 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FUT10 gene in the plasmid vector map.
PVT22374 pCMV-SPORT6-FCER2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FCER2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FCER2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FCER2 gene in the plasmid vector map.
PVT22375 pCMV-SPORT6-ORC6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ORC6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ORC6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ORC6 gene in the plasmid vector map.
PVT22376 pCMV-SPORT6-NIPAL3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NIPAL3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NIPAL3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NIPAL3 gene in the plasmid vector map.
PVT22377 pCMV-SPORT6-TBC1D10C Gentaur supplies 2ug of lyophilized CMV-SPORT6-TBC1D10C Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TBC1D10C plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TBC1D10C gene in the plasmid vector map.
PVT22378 pCMV-SPORT6-ELK4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ELK4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ELK4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ELK4 gene in the plasmid vector map.
PVT22379 pCMV-SPORT6-HAT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-HAT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HAT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HAT1 gene in the plasmid vector map.
PVT22380 pCMV-SPORT6-ST7L Gentaur supplies 2ug of lyophilized CMV-SPORT6-ST7L Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ST7L plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ST7L gene in the plasmid vector map.
PVT22381 pCMV-SPORT6-LAMTOR5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LAMTOR5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LAMTOR5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LAMTOR5 gene in the plasmid vector map.
PVT22382 pCMV-SPORT6-PPP2R3B Gentaur supplies 2ug of lyophilized CMV-SPORT6-PPP2R3B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PPP2R3B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PPP2R3B gene in the plasmid vector map.
PVT22383 pCMV-SPORT6-MCAM Gentaur supplies 2ug of lyophilized CMV-SPORT6-MCAM Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MCAM plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MCAM gene in the plasmid vector map.
PVT22384 pCMV-SPORT6-GTF2H5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GTF2H5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GTF2H5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GTF2H5 gene in the plasmid vector map.
PVT22385 pCMV-SPORT6-RAB22A Gentaur supplies 2ug of lyophilized CMV-SPORT6-RAB22A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RAB22A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RAB22A gene in the plasmid vector map.
PVT22386 pCMV-SPORT6-ZNF558 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF558 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF558 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF558 gene in the plasmid vector map.
PVT22387 pCMV-SPORT6-ABL2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ABL2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ABL2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ABL2 gene in the plasmid vector map.
PVT22388 pCMV-SPORT6-ATP6V0D2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ATP6V0D2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ATP6V0D2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ATP6V0D2 gene in the plasmid vector map.
PVT22389 pCMV-SPORT6-RGS20 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RGS20 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RGS20 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RGS20 gene in the plasmid vector map.
PVT22390 pCMV-SPORT6-PNN Gentaur supplies 2ug of lyophilized CMV-SPORT6-PNN Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PNN plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PNN gene in the plasmid vector map.
PVT22391 pBluescriptR-HIBCH Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-HIBCH plasmid. The pBluescriptR promotor is combined with a HIBCH vector sequence and a  gene in the plasmid vector map.
PVT22392 pBluescriptR-ARPC3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ARPC3 plasmid. The pBluescriptR promotor is combined with a ARPC3 vector sequence and a  gene in the plasmid vector map.
PVT22393 pBluescriptR-S1PR5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-S1PR5 plasmid. The pBluescriptR promotor is combined with a S1PR5 vector sequence and a  gene in the plasmid vector map.
PVT22394 pBluescriptR-SDHC Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SDHC plasmid. The pBluescriptR promotor is combined with a SDHC vector sequence and a  gene in the plasmid vector map.
PVT22395 pBluescriptR-IGFBP7 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-IGFBP7 plasmid. The pBluescriptR promotor is combined with a IGFBP7 vector sequence and a  gene in the plasmid vector map.
PVT22396 pBluescriptR-AMN1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-AMN1 plasmid. The pBluescriptR promotor is combined with a AMN1 vector sequence and a  gene in the plasmid vector map.
PVT22397 pBluescriptR-PHTF2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PHTF2 plasmid. The pBluescriptR promotor is combined with a PHTF2 vector sequence and a  gene in the plasmid vector map.
PVT22398 pBluescriptR-ENSA Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ENSA plasmid. The pBluescriptR promotor is combined with a ENSA vector sequence and a  gene in the plasmid vector map.
PVT22399 pBluescriptR-TDGF1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TDGF1 plasmid. The pBluescriptR promotor is combined with a TDGF1 vector sequence and a  gene in the plasmid vector map.
PVT22400 pBluescriptR-RPL22 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RPL22 plasmid. The pBluescriptR promotor is combined with a RPL22 vector sequence and a  gene in the plasmid vector map.
PVT22401 pBluescriptR-KHDRBS3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-KHDRBS3 plasmid. The pBluescriptR promotor is combined with a KHDRBS3 vector sequence and a  gene in the plasmid vector map.
PVT22402 pBluescriptR-RFX3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RFX3 plasmid. The pBluescriptR promotor is combined with a RFX3 vector sequence and a  gene in the plasmid vector map.
PVT22403 pBluescriptR-LOC150763 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LOC150763 plasmid. The pBluescriptR promotor is combined with a LOC150763 vector sequence and a  gene in the plasmid vector map.
PVT22404 pBluescriptR-CCDC144NL Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CCDC144NL plasmid. The pBluescriptR promotor is combined with a CCDC144NL vector sequence and a  gene in the plasmid vector map.
PVT22405 pBluescriptR-NT5C3L Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NT5C3L plasmid. The pBluescriptR promotor is combined with a NT5C3L vector sequence and a  gene in the plasmid vector map.
PVT22406 pBluescriptR-GUSBP14 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GUSBP14 plasmid. The pBluescriptR promotor is combined with a GUSBP14 vector sequence and a  gene in the plasmid vector map.
PVT22407 pBluescriptR-C9orf72 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-C9orf72 plasmid. The pBluescriptR promotor is combined with a C9orf72 vector sequence and a  gene in the plasmid vector map.
PVT22408 pBluescriptR-CCNL1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CCNL1 plasmid. The pBluescriptR promotor is combined with a CCNL1 vector sequence and a  gene in the plasmid vector map.
PVT22409 pOTB7-DDR1 Gentaur supplies 2ug of lyophilized OTB7-DDR1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-DDR1 plasmid. The pOTB7 promotor is combined with a DDR1 vector sequence and a  gene in the plasmid vector map.
PVT22410 pBluescriptR-CYCS Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CYCS plasmid. The pBluescriptR promotor is combined with a CYCS vector sequence and a  gene in the plasmid vector map.
PVT22411 pBluescriptR-RGCC Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RGCC plasmid. The pBluescriptR promotor is combined with a RGCC vector sequence and a  gene in the plasmid vector map.
PVT22412 pOTB7-MFSD5 Gentaur supplies 2ug of lyophilized OTB7-MFSD5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pOTB7-MFSD5 plasmid. The pOTB7 promotor is combined with a MFSD5 vector sequence and a  gene in the plasmid vector map.
PVT22413 pBluescriptR-PSMD14 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PSMD14 plasmid. The pBluescriptR promotor is combined with a PSMD14 vector sequence and a  gene in the plasmid vector map.
PVT22414 pBluescriptR-ADO Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ADO plasmid. The pBluescriptR promotor is combined with a ADO vector sequence and a  gene in the plasmid vector map.
PVT22415 pBluescriptR-SRSF2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SRSF2 plasmid. The pBluescriptR promotor is combined with a SRSF2 vector sequence and a  gene in the plasmid vector map.
PVT22416 pBluescriptR-FAM53A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FAM53A plasmid. The pBluescriptR promotor is combined with a FAM53A vector sequence and a  gene in the plasmid vector map.
PVT22417 pBluescriptR-EEF1B2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-EEF1B2 plasmid. The pBluescriptR promotor is combined with a EEF1B2 vector sequence and a  gene in the plasmid vector map.
PVT22418 pBluescriptR-AKAP14 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-AKAP14 plasmid. The pBluescriptR promotor is combined with a AKAP14 vector sequence and a  gene in the plasmid vector map.
PVT22419 pBluescriptR-MLC1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MLC1 plasmid. The pBluescriptR promotor is combined with a MLC1 vector sequence and a  gene in the plasmid vector map.
PVT22420 pBluescriptR-NECTIN3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NECTIN3 plasmid. The pBluescriptR promotor is combined with a NECTIN3 vector sequence and a  gene in the plasmid vector map.
PVT22421 pBluescriptR-RPL27A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RPL27A plasmid. The pBluescriptR promotor is combined with a RPL27A vector sequence and a  gene in the plasmid vector map.
PVT22422 pBluescriptR-IMPAD1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-IMPAD1 plasmid. The pBluescriptR promotor is combined with a IMPAD1 vector sequence and a  gene in the plasmid vector map.
PVT22423 pBluescriptR-Kif2c Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-Kif2c plasmid. The pBluescriptR promotor is combined with a Kif2c vector sequence and a  gene in the plasmid vector map.
PVT22424 pBluescriptR-KCTD9 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-KCTD9 plasmid. The pBluescriptR promotor is combined with a KCTD9 vector sequence and a  gene in the plasmid vector map.
PVT22425 pBluescriptR-FAM156A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FAM156A plasmid. The pBluescriptR promotor is combined with a FAM156A vector sequence and a  gene in the plasmid vector map.
PVT22426 pBluescriptR-HIST1H3A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-HIST1H3A plasmid. The pBluescriptR promotor is combined with a HIST1H3A vector sequence and a  gene in the plasmid vector map.
PVT22427 pBluescriptR-SETD7 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SETD7 plasmid. The pBluescriptR promotor is combined with a SETD7 vector sequence and a  gene in the plasmid vector map.
PVT22428 pBluescriptR-PUS7L Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PUS7L plasmid. The pBluescriptR promotor is combined with a PUS7L vector sequence and a  gene in the plasmid vector map.
PVT22429 pBluescriptR-SPTSSA Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SPTSSA plasmid. The pBluescriptR promotor is combined with a SPTSSA vector sequence and a  gene in the plasmid vector map.
PVT22430 pBluescriptR-DDX53 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-DDX53 plasmid. The pBluescriptR promotor is combined with a DDX53 vector sequence and a  gene in the plasmid vector map.
PVT22431 pBluescriptR-GGPS1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GGPS1 plasmid. The pBluescriptR promotor is combined with a GGPS1 vector sequence and a  gene in the plasmid vector map.
PVT22432 pBluescriptR-ERLIN2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ERLIN2 plasmid. The pBluescriptR promotor is combined with a ERLIN2 vector sequence and a  gene in the plasmid vector map.
PVT22433 pBluescriptR-RPL18A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RPL18A plasmid. The pBluescriptR promotor is combined with a RPL18A vector sequence and a  gene in the plasmid vector map.
PVT22434 pBluescriptR-LOC100506071 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LOC100506071 plasmid. The pBluescriptR promotor is combined with a LOC100506071 vector sequence and a  gene in the plasmid vector map.
PVT22435 pBluescriptR-RCHY1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RCHY1 plasmid. The pBluescriptR promotor is combined with a RCHY1 vector sequence and a  gene in the plasmid vector map.
PVT22436 pBluescriptR-TXNDC9 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TXNDC9 plasmid. The pBluescriptR promotor is combined with a TXNDC9 vector sequence and a  gene in the plasmid vector map.
PVT22437 pBluescriptR-RPS2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RPS2 plasmid. The pBluescriptR promotor is combined with a RPS2 vector sequence and a  gene in the plasmid vector map.
PVT22438 pBluescriptR-SRA1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SRA1 plasmid. The pBluescriptR promotor is combined with a SRA1 vector sequence and a  gene in the plasmid vector map.
PVT22439 pBluescriptR-MMD2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MMD2 plasmid. The pBluescriptR promotor is combined with a MMD2 vector sequence and a  gene in the plasmid vector map.
PVT22440 pBluescriptR-HDDC2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-HDDC2 plasmid. The pBluescriptR promotor is combined with a HDDC2 vector sequence and a  gene in the plasmid vector map.
PVT22441 pBluescriptR-MINDY3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MINDY3 plasmid. The pBluescriptR promotor is combined with a MINDY3 vector sequence and a  gene in the plasmid vector map.
PVT22442 pBluescriptR-PDXDC1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PDXDC1 plasmid. The pBluescriptR promotor is combined with a PDXDC1 vector sequence and a  gene in the plasmid vector map.
PVT22443 pBluescriptR-UBE2Q2P2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-UBE2Q2P2 plasmid. The pBluescriptR promotor is combined with a UBE2Q2P2 vector sequence and a  gene in the plasmid vector map.
PVT22444 pBluescriptR-CBWD5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CBWD5 plasmid. The pBluescriptR promotor is combined with a CBWD5 vector sequence and a  gene in the plasmid vector map.
PVT22445 pBluescriptR-FZD10 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FZD10 plasmid. The pBluescriptR promotor is combined with a FZD10 vector sequence and a  gene in the plasmid vector map.
PVT22446 pBluescriptR-RGMB Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RGMB plasmid. The pBluescriptR promotor is combined with a RGMB vector sequence and a  gene in the plasmid vector map.
PVT22447 pBluescriptR-LARP7 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LARP7 plasmid. The pBluescriptR promotor is combined with a LARP7 vector sequence and a  gene in the plasmid vector map.
PVT22448 pBluescriptR-WDR25 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-WDR25 plasmid. The pBluescriptR promotor is combined with a WDR25 vector sequence and a  gene in the plasmid vector map.
PVT22449 pBluescriptR-WDR55 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-WDR55 plasmid. The pBluescriptR promotor is combined with a WDR55 vector sequence and a  gene in the plasmid vector map.
PVT22450 pBluescriptR-XAGE2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-XAGE2 plasmid. The pBluescriptR promotor is combined with a XAGE2 vector sequence and a  gene in the plasmid vector map.
PVT22451 pBluescriptR-YPEL5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-YPEL5 plasmid. The pBluescriptR promotor is combined with a YPEL5 vector sequence and a  gene in the plasmid vector map.
PVT22452 pBluescriptR-SLC6A15 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SLC6A15 plasmid. The pBluescriptR promotor is combined with a SLC6A15 vector sequence and a  gene in the plasmid vector map.
PVT22453 pBluescriptR-MAMDC2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MAMDC2 plasmid. The pBluescriptR promotor is combined with a MAMDC2 vector sequence and a  gene in the plasmid vector map.
PVT22454 pBluescriptR-DOK6 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-DOK6 plasmid. The pBluescriptR promotor is combined with a DOK6 vector sequence and a  gene in the plasmid vector map.
PVT22455 pBluescriptR-REEP3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-REEP3 plasmid. The pBluescriptR promotor is combined with a REEP3 vector sequence and a  gene in the plasmid vector map.
PVT22456 pBluescriptR-HHAT Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-HHAT plasmid. The pBluescriptR promotor is combined with a HHAT vector sequence and a  gene in the plasmid vector map.
PVT22457 pBluescriptR-SPDYE8 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SPDYE8 plasmid. The pBluescriptR promotor is combined with a SPDYE8 vector sequence and a  gene in the plasmid vector map.
PVT22458 pBluescriptR-PLAC1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PLAC1 plasmid. The pBluescriptR promotor is combined with a PLAC1 vector sequence and a  gene in the plasmid vector map.
PVT22459 pBluescriptR-LRRC8E Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LRRC8E plasmid. The pBluescriptR promotor is combined with a LRRC8E vector sequence and a  gene in the plasmid vector map.
PVT22460 pBluescriptR-NCCRP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NCCRP1 plasmid. The pBluescriptR promotor is combined with a NCCRP1 vector sequence and a  gene in the plasmid vector map.
PVT22461 pBluescriptR-D2HGDH Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-D2HGDH plasmid. The pBluescriptR promotor is combined with a D2HGDH vector sequence and a  gene in the plasmid vector map.
PVT22462 pBluescriptR-ADGRG6 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ADGRG6 plasmid. The pBluescriptR promotor is combined with a ADGRG6 vector sequence and a  gene in the plasmid vector map.
PVT22463 pBluescriptR-KIAA0748 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-KIAA0748 plasmid. The pBluescriptR promotor is combined with a KIAA0748 vector sequence and a  gene in the plasmid vector map.
PVT22464 pBluescriptR-ERVFRD-1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ERVFRD-1 plasmid. The pBluescriptR promotor is combined with a ERVFRD vector sequence and a 1 gene in the plasmid vector map.
PVT22465 pBluescriptR-PTP4A1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PTP4A1 plasmid. The pBluescriptR promotor is combined with a PTP4A1 vector sequence and a  gene in the plasmid vector map.
PVT22466 pBluescriptR-ZNF599 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ZNF599 plasmid. The pBluescriptR promotor is combined with a ZNF599 vector sequence and a  gene in the plasmid vector map.
PVT22467 pBluescriptR-AHR Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-AHR plasmid. The pBluescriptR promotor is combined with a AHR vector sequence and a  gene in the plasmid vector map.
PVT22468 pBluescriptR-ZNF23 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ZNF23 plasmid. The pBluescriptR promotor is combined with a ZNF23 vector sequence and a  gene in the plasmid vector map.
PVT22469 pBluescriptR-GRPEL2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GRPEL2 plasmid. The pBluescriptR promotor is combined with a GRPEL2 vector sequence and a  gene in the plasmid vector map.
PVT22470 pBluescriptR-COBLL1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-COBLL1 plasmid. The pBluescriptR promotor is combined with a COBLL1 vector sequence and a  gene in the plasmid vector map.
PVT22471 pBluescriptR-NKAPD1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NKAPD1 plasmid. The pBluescriptR promotor is combined with a NKAPD1 vector sequence and a  gene in the plasmid vector map.
PVT22472 pBluescriptR-TBCK Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TBCK plasmid. The pBluescriptR promotor is combined with a TBCK vector sequence and a  gene in the plasmid vector map.
PVT22473 pBluescriptR-GPR1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GPR1 plasmid. The pBluescriptR promotor is combined with a GPR1 vector sequence and a  gene in the plasmid vector map.
PVT22474 pBluescriptR-SLC25A51P4 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SLC25A51P4 plasmid. The pBluescriptR promotor is combined with a SLC25A51P4 vector sequence and a  gene in the plasmid vector map.
PVT22475 pBluescriptR-TCAIM Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TCAIM plasmid. The pBluescriptR promotor is combined with a TCAIM vector sequence and a  gene in the plasmid vector map.
PVT22476 pBluescriptR-TMEM41B Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TMEM41B plasmid. The pBluescriptR promotor is combined with a TMEM41B vector sequence and a  gene in the plasmid vector map.
PVT22477 pBluescriptR-FLJ90650 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FLJ90650 plasmid. The pBluescriptR promotor is combined with a FLJ90650 vector sequence and a  gene in the plasmid vector map.
PVT22478 pBluescriptR-UQCC Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-UQCC plasmid. The pBluescriptR promotor is combined with a UQCC vector sequence and a  gene in the plasmid vector map.
PVT22479 pBluescriptR-RBM48 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RBM48 plasmid. The pBluescriptR promotor is combined with a RBM48 vector sequence and a  gene in the plasmid vector map.
PVT22480 pBluescriptR-VCAM1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-VCAM1 plasmid. The pBluescriptR promotor is combined with a VCAM1 vector sequence and a  gene in the plasmid vector map.
PVT22481 pBluescriptR-CARD8 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CARD8 plasmid. The pBluescriptR promotor is combined with a CARD8 vector sequence and a  gene in the plasmid vector map.
PVT22482 pBluescriptR-VASN Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-VASN plasmid. The pBluescriptR promotor is combined with a VASN vector sequence and a  gene in the plasmid vector map.
PVT22483 pBluescriptR-SPDYA Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SPDYA plasmid. The pBluescriptR promotor is combined with a SPDYA vector sequence and a  gene in the plasmid vector map.
PVT22484 pBluescriptR-CLEC1A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CLEC1A plasmid. The pBluescriptR promotor is combined with a CLEC1A vector sequence and a  gene in the plasmid vector map.
PVT22485 pBluescriptR-GLYR1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GLYR1 plasmid. The pBluescriptR promotor is combined with a GLYR1 vector sequence and a  gene in the plasmid vector map.
PVT22486 pBluescriptR-RAB26 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RAB26 plasmid. The pBluescriptR promotor is combined with a RAB26 vector sequence and a  gene in the plasmid vector map.
PVT22487 pBluescriptR-NMUR2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NMUR2 plasmid. The pBluescriptR promotor is combined with a NMUR2 vector sequence and a  gene in the plasmid vector map.
PVT22488 pBluescriptR-LRRC37A3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LRRC37A3 plasmid. The pBluescriptR promotor is combined with a LRRC37A3 vector sequence and a  gene in the plasmid vector map.
PVT22489 pBluescriptR-MYORG Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MYORG plasmid. The pBluescriptR promotor is combined with a MYORG vector sequence and a  gene in the plasmid vector map.
PVT22490 pBluescriptR-RAB6A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RAB6A plasmid. The pBluescriptR promotor is combined with a RAB6A vector sequence and a  gene in the plasmid vector map.
PVT22491 pBluescriptR-CALCB Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CALCB plasmid. The pBluescriptR promotor is combined with a CALCB vector sequence and a  gene in the plasmid vector map.
PVT22492 pBluescriptR-EXOC1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-EXOC1 plasmid. The pBluescriptR promotor is combined with a EXOC1 vector sequence and a  gene in the plasmid vector map.
PVT22493 pBluescriptR-ZNF565 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ZNF565 plasmid. The pBluescriptR promotor is combined with a ZNF565 vector sequence and a  gene in the plasmid vector map.
PVT22494 pBluescriptR-PITRM1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PITRM1 plasmid. The pBluescriptR promotor is combined with a PITRM1 vector sequence and a  gene in the plasmid vector map.
PVT22495 pBluescriptR-AHI1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-AHI1 plasmid. The pBluescriptR promotor is combined with a AHI1 vector sequence and a  gene in the plasmid vector map.
PVT22496 pBluescriptR-WDR11 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-WDR11 plasmid. The pBluescriptR promotor is combined with a WDR11 vector sequence and a  gene in the plasmid vector map.
PVT22497 pBluescriptR-DENND5A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-DENND5A plasmid. The pBluescriptR promotor is combined with a DENND5A vector sequence and a  gene in the plasmid vector map.
PVT22498 pBluescriptR-CCDC93 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CCDC93 plasmid. The pBluescriptR promotor is combined with a CCDC93 vector sequence and a  gene in the plasmid vector map.
PVT22499 pBluescriptR-DACT2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-DACT2 plasmid. The pBluescriptR promotor is combined with a DACT2 vector sequence and a  gene in the plasmid vector map.
PVT22500 pBluescriptR-ARFRP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ARFRP1 plasmid. The pBluescriptR promotor is combined with a ARFRP1 vector sequence and a  gene in the plasmid vector map.
PVT22501 pBluescriptR-NDRG2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NDRG2 plasmid. The pBluescriptR promotor is combined with a NDRG2 vector sequence and a  gene in the plasmid vector map.
PVT22502 pBluescriptR-LOXL1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LOXL1 plasmid. The pBluescriptR promotor is combined with a LOXL1 vector sequence and a  gene in the plasmid vector map.
PVT22503 pBluescriptR-SLC2A11 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SLC2A11 plasmid. The pBluescriptR promotor is combined with a SLC2A11 vector sequence and a  gene in the plasmid vector map.
PVT22504 pBluescriptR-BCL7A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-BCL7A plasmid. The pBluescriptR promotor is combined with a BCL7A vector sequence and a  gene in the plasmid vector map.
PVT22505 pBluescriptR-YWHAZ Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-YWHAZ plasmid. The pBluescriptR promotor is combined with a YWHAZ vector sequence and a  gene in the plasmid vector map.
PVT22506 pBluescriptR-PWWP2B Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PWWP2B plasmid. The pBluescriptR promotor is combined with a PWWP2B vector sequence and a  gene in the plasmid vector map.
PVT22507 pBluescriptR-ARHGAP26 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ARHGAP26 plasmid. The pBluescriptR promotor is combined with a ARHGAP26 vector sequence and a  gene in the plasmid vector map.
PVT22508 pBluescriptR-TRABD Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TRABD plasmid. The pBluescriptR promotor is combined with a TRABD vector sequence and a  gene in the plasmid vector map.
PVT22509 pBluescriptR-PLAC9 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PLAC9 plasmid. The pBluescriptR promotor is combined with a PLAC9 vector sequence and a  gene in the plasmid vector map.
PVT22510 pBluescriptR-GMPR2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GMPR2 plasmid. The pBluescriptR promotor is combined with a GMPR2 vector sequence and a  gene in the plasmid vector map.
PVT22511 pBluescriptR-PTK7 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PTK7 plasmid. The pBluescriptR promotor is combined with a PTK7 vector sequence and a  gene in the plasmid vector map.
PVT22512 pBluescriptR-FOXO3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FOXO3 plasmid. The pBluescriptR promotor is combined with a FOXO3 vector sequence and a  gene in the plasmid vector map.
PVT22513 pBluescriptR-LTBP2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LTBP2 plasmid. The pBluescriptR promotor is combined with a LTBP2 vector sequence and a  gene in the plasmid vector map.
PVT22514 pBluescriptR-ALPP Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ALPP plasmid. The pBluescriptR promotor is combined with a ALPP vector sequence and a  gene in the plasmid vector map.
PVT22515 pBluescriptR-ENAH Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ENAH plasmid. The pBluescriptR promotor is combined with a ENAH vector sequence and a  gene in the plasmid vector map.
PVT22516 pBluescriptR-VPS35 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-VPS35 plasmid. The pBluescriptR promotor is combined with a VPS35 vector sequence and a  gene in the plasmid vector map.
PVT22517 pBluescriptR-DNAJC15 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-DNAJC15 plasmid. The pBluescriptR promotor is combined with a DNAJC15 vector sequence and a  gene in the plasmid vector map.
PVT22518 pBluescriptR-ALS2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ALS2 plasmid. The pBluescriptR promotor is combined with a ALS2 vector sequence and a  gene in the plasmid vector map.
PVT22519 pBluescriptR-C18orf32 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-C18orf32 plasmid. The pBluescriptR promotor is combined with a C18orf32 vector sequence and a  gene in the plasmid vector map.
PVT22520 pBluescriptR-SLC11A2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SLC11A2 plasmid. The pBluescriptR promotor is combined with a SLC11A2 vector sequence and a  gene in the plasmid vector map.
PVT22521 pBluescriptR-ZFAND4 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ZFAND4 plasmid. The pBluescriptR promotor is combined with a ZFAND4 vector sequence and a  gene in the plasmid vector map.
PVT22522 pBluescriptR-ANXA2R Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ANXA2R plasmid. The pBluescriptR promotor is combined with a ANXA2R vector sequence and a  gene in the plasmid vector map.
PVT22523 pBluescriptR-SPP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SPP1 plasmid. The pBluescriptR promotor is combined with a SPP1 vector sequence and a  gene in the plasmid vector map.
PVT22524 pBluescriptR-MYO1E Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MYO1E plasmid. The pBluescriptR promotor is combined with a MYO1E vector sequence and a  gene in the plasmid vector map.
PVT22525 pBluescriptR-CREB1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CREB1 plasmid. The pBluescriptR promotor is combined with a CREB1 vector sequence and a  gene in the plasmid vector map.
PVT22526 pBluescriptR-PKIB Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PKIB plasmid. The pBluescriptR promotor is combined with a PKIB vector sequence and a  gene in the plasmid vector map.
PVT22527 pBluescriptR-YWHAQ Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-YWHAQ plasmid. The pBluescriptR promotor is combined with a YWHAQ vector sequence and a  gene in the plasmid vector map.
PVT22528 pBluescriptR-NIPAL1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NIPAL1 plasmid. The pBluescriptR promotor is combined with a NIPAL1 vector sequence and a  gene in the plasmid vector map.
PVT22529 pBluescriptR-SGPP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SGPP1 plasmid. The pBluescriptR promotor is combined with a SGPP1 vector sequence and a  gene in the plasmid vector map.
PVT22530 pBluescriptR-MYH9 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MYH9 plasmid. The pBluescriptR promotor is combined with a MYH9 vector sequence and a  gene in the plasmid vector map.
PVT22531 pBluescriptR-ATP1A4 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ATP1A4 plasmid. The pBluescriptR promotor is combined with a ATP1A4 vector sequence and a  gene in the plasmid vector map.
PVT22532 pBluescriptR-OXLD1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-OXLD1 plasmid. The pBluescriptR promotor is combined with a OXLD1 vector sequence and a  gene in the plasmid vector map.
PVT22533 pBluescriptR-GUK1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GUK1 plasmid. The pBluescriptR promotor is combined with a GUK1 vector sequence and a  gene in the plasmid vector map.
PVT22534 pBluescriptR-BLOC1S4 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-BLOC1S4 plasmid. The pBluescriptR promotor is combined with a BLOC1S4 vector sequence and a  gene in the plasmid vector map.
PVT22535 pBluescriptR-PKM2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PKM2 plasmid. The pBluescriptR promotor is combined with a PKM2 vector sequence and a  gene in the plasmid vector map.
PVT22536 pBluescriptR-BDH2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-BDH2 plasmid. The pBluescriptR promotor is combined with a BDH2 vector sequence and a  gene in the plasmid vector map.
PVT22537 pBluescriptR-CADM2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CADM2 plasmid. The pBluescriptR promotor is combined with a CADM2 vector sequence and a  gene in the plasmid vector map.
PVT22538 pBluescriptR-SVOP Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SVOP plasmid. The pBluescriptR promotor is combined with a SVOP vector sequence and a  gene in the plasmid vector map.
PVT22539 pBluescriptR-COPS4 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-COPS4 plasmid. The pBluescriptR promotor is combined with a COPS4 vector sequence and a  gene in the plasmid vector map.
PVT22540 pBluescriptR-PKP2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PKP2 plasmid. The pBluescriptR promotor is combined with a PKP2 vector sequence and a  gene in the plasmid vector map.
PVT22541 pBluescriptR-YIF1B Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-YIF1B plasmid. The pBluescriptR promotor is combined with a YIF1B vector sequence and a  gene in the plasmid vector map.
PVT22542 pBluescriptR-TMEM128 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TMEM128 plasmid. The pBluescriptR promotor is combined with a TMEM128 vector sequence and a  gene in the plasmid vector map.
PVT22543 pBluescriptR-METTL5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-METTL5 plasmid. The pBluescriptR promotor is combined with a METTL5 vector sequence and a  gene in the plasmid vector map.
PVT22544 pBluescriptR-ACP2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ACP2 plasmid. The pBluescriptR promotor is combined with a ACP2 vector sequence and a  gene in the plasmid vector map.
PVT22545 pBluescriptR-LOC90835 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LOC90835 plasmid. The pBluescriptR promotor is combined with a LOC90835 vector sequence and a  gene in the plasmid vector map.
PVT22546 pBluescriptR-TTC32 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TTC32 plasmid. The pBluescriptR promotor is combined with a TTC32 vector sequence and a  gene in the plasmid vector map.
PVT22547 pBluescriptR-MACROH2A1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MACROH2A1 plasmid. The pBluescriptR promotor is combined with a MACROH2A1 vector sequence and a  gene in the plasmid vector map.
PVT22548 pBluescriptR-UNC50 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-UNC50 plasmid. The pBluescriptR promotor is combined with a UNC50 vector sequence and a  gene in the plasmid vector map.
PVT22549 pBluescriptR-SELP Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SELP plasmid. The pBluescriptR promotor is combined with a SELP vector sequence and a  gene in the plasmid vector map.
PVT22550 pBluescriptR-RBPMS Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RBPMS plasmid. The pBluescriptR promotor is combined with a RBPMS vector sequence and a  gene in the plasmid vector map.
PVT22551 pBluescriptR-PPP2R5E Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PPP2R5E plasmid. The pBluescriptR promotor is combined with a PPP2R5E vector sequence and a  gene in the plasmid vector map.
PVT22552 pBluescriptR-POLRMT Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-POLRMT plasmid. The pBluescriptR promotor is combined with a POLRMT vector sequence and a  gene in the plasmid vector map.
PVT22553 pBluescriptR-GTF2I Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GTF2I plasmid. The pBluescriptR promotor is combined with a GTF2I vector sequence and a  gene in the plasmid vector map.
PVT22554 pBluescriptR-ATG5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ATG5 plasmid. The pBluescriptR promotor is combined with a ATG5 vector sequence and a  gene in the plasmid vector map.
PVT22555 pBluescriptR-UNC93B1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-UNC93B1 plasmid. The pBluescriptR promotor is combined with a UNC93B1 vector sequence and a  gene in the plasmid vector map.
PVT22556 pBluescriptR-ARHGAP12 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ARHGAP12 plasmid. The pBluescriptR promotor is combined with a ARHGAP12 vector sequence and a  gene in the plasmid vector map.
PVT22557 pBluescriptR-CHID1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CHID1 plasmid. The pBluescriptR promotor is combined with a CHID1 vector sequence and a  gene in the plasmid vector map.
PVT22558 pBluescriptR-MFF Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MFF plasmid. The pBluescriptR promotor is combined with a MFF vector sequence and a  gene in the plasmid vector map.
PVT22559 pBluescriptR-SEC23B Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SEC23B plasmid. The pBluescriptR promotor is combined with a SEC23B vector sequence and a  gene in the plasmid vector map.
PVT22560 pBluescriptR-SLC52A1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SLC52A1 plasmid. The pBluescriptR promotor is combined with a SLC52A1 vector sequence and a  gene in the plasmid vector map.
PVT22561 pBluescriptR-AKTIP Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-AKTIP plasmid. The pBluescriptR promotor is combined with a AKTIP vector sequence and a  gene in the plasmid vector map.
PVT22562 pBluescriptR-PSMA8 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PSMA8 plasmid. The pBluescriptR promotor is combined with a PSMA8 vector sequence and a  gene in the plasmid vector map.
PVT22563 pBluescriptR-BCKDHB Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-BCKDHB plasmid. The pBluescriptR promotor is combined with a BCKDHB vector sequence and a  gene in the plasmid vector map.
PVT22564 pBluescriptR-SPPL2C Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SPPL2C plasmid. The pBluescriptR promotor is combined with a SPPL2C vector sequence and a  gene in the plasmid vector map.
PVT22565 pBluescriptR-SNRPD2P2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SNRPD2P2 plasmid. The pBluescriptR promotor is combined with a SNRPD2P2 vector sequence and a  gene in the plasmid vector map.
PVT22566 pBluescriptR-ZNF532 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ZNF532 plasmid. The pBluescriptR promotor is combined with a ZNF532 vector sequence and a  gene in the plasmid vector map.
PVT22567 pBluescriptR-PRR16 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PRR16 plasmid. The pBluescriptR promotor is combined with a PRR16 vector sequence and a  gene in the plasmid vector map.
PVT22568 pBluescriptR-RANBP6 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RANBP6 plasmid. The pBluescriptR promotor is combined with a RANBP6 vector sequence and a  gene in the plasmid vector map.
PVT22569 pBluescriptR-SLC26A7 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SLC26A7 plasmid. The pBluescriptR promotor is combined with a SLC26A7 vector sequence and a  gene in the plasmid vector map.
PVT22570 pBluescriptR-COPS7A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-COPS7A plasmid. The pBluescriptR promotor is combined with a COPS7A vector sequence and a  gene in the plasmid vector map.
PVT22571 pBluescriptR-PIK3R1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PIK3R1 plasmid. The pBluescriptR promotor is combined with a PIK3R1 vector sequence and a  gene in the plasmid vector map.
PVT22572 pBluescriptR-REV1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-REV1 plasmid. The pBluescriptR promotor is combined with a REV1 vector sequence and a  gene in the plasmid vector map.
PVT22573 pBluescriptR-MOK Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MOK plasmid. The pBluescriptR promotor is combined with a MOK vector sequence and a  gene in the plasmid vector map.
PVT22574 pBluescriptR-RASIP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RASIP1 plasmid. The pBluescriptR promotor is combined with a RASIP1 vector sequence and a  gene in the plasmid vector map.
PVT22575 pBluescriptR-VGLL3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-VGLL3 plasmid. The pBluescriptR promotor is combined with a VGLL3 vector sequence and a  gene in the plasmid vector map.
PVT22576 pBluescriptR-C6orf89 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-C6orf89 plasmid. The pBluescriptR promotor is combined with a C6orf89 vector sequence and a  gene in the plasmid vector map.
PVT22577 pBluescriptR-MORF4L2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MORF4L2 plasmid. The pBluescriptR promotor is combined with a MORF4L2 vector sequence and a  gene in the plasmid vector map.
PVT22578 pBluescriptR-CKLF Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CKLF plasmid. The pBluescriptR promotor is combined with a CKLF vector sequence and a  gene in the plasmid vector map.
PVT22579 pBluescriptR-ZNF876P Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ZNF876P plasmid. The pBluescriptR promotor is combined with a ZNF876P vector sequence and a  gene in the plasmid vector map.
PVT22580 pBluescriptR-LRRC6 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-LRRC6 plasmid. The pBluescriptR promotor is combined with a LRRC6 vector sequence and a  gene in the plasmid vector map.
PVT22581 pBluescriptR-CLK1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CLK1 plasmid. The pBluescriptR promotor is combined with a CLK1 vector sequence and a  gene in the plasmid vector map.
PVT22582 pBluescriptR-AK5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-AK5 plasmid. The pBluescriptR promotor is combined with a AK5 vector sequence and a  gene in the plasmid vector map.
PVT22583 pBluescriptR-NUP214 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-NUP214 plasmid. The pBluescriptR promotor is combined with a NUP214 vector sequence and a  gene in the plasmid vector map.
PVT22584 pBluescriptR-UBXN2A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-UBXN2A plasmid. The pBluescriptR promotor is combined with a UBXN2A vector sequence and a  gene in the plasmid vector map.
PVT22585 pBluescriptR-RAB21 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RAB21 plasmid. The pBluescriptR promotor is combined with a RAB21 vector sequence and a  gene in the plasmid vector map.
PVT22586 pBluescriptR-MYADM Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MYADM plasmid. The pBluescriptR promotor is combined with a MYADM vector sequence and a  gene in the plasmid vector map.
PVT22587 pBluescriptR-ACER2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ACER2 plasmid. The pBluescriptR promotor is combined with a ACER2 vector sequence and a  gene in the plasmid vector map.
PVT22588 pBluescriptR-MAT2B Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MAT2B plasmid. The pBluescriptR promotor is combined with a MAT2B vector sequence and a  gene in the plasmid vector map.
PVT22589 pBluescriptR-ACSL6 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ACSL6 plasmid. The pBluescriptR promotor is combined with a ACSL6 vector sequence and a  gene in the plasmid vector map.
PVT22590 pBluescriptR-TCTEX1D4 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TCTEX1D4 plasmid. The pBluescriptR promotor is combined with a TCTEX1D4 vector sequence and a  gene in the plasmid vector map.
PVT22591 pBluescriptR-MSRB2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MSRB2 plasmid. The pBluescriptR promotor is combined with a MSRB2 vector sequence and a  gene in the plasmid vector map.
PVT22592 pBluescriptR-RGS9 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RGS9 plasmid. The pBluescriptR promotor is combined with a RGS9 vector sequence and a  gene in the plasmid vector map.
PVT22593 pBluescriptR-FKSG24 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FKSG24 plasmid. The pBluescriptR promotor is combined with a FKSG24 vector sequence and a  gene in the plasmid vector map.
PVT22594 pBluescriptR-STRIP1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-STRIP1 plasmid. The pBluescriptR promotor is combined with a STRIP1 vector sequence and a  gene in the plasmid vector map.
PVT22595 pBluescriptR-UBE2J2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-UBE2J2 plasmid. The pBluescriptR promotor is combined with a UBE2J2 vector sequence and a  gene in the plasmid vector map.
PVT22596 pBluescriptR-CXCL9 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CXCL9 plasmid. The pBluescriptR promotor is combined with a CXCL9 vector sequence and a  gene in the plasmid vector map.
PVT22597 pBluescriptR-HDHD2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-HDHD2 plasmid. The pBluescriptR promotor is combined with a HDHD2 vector sequence and a  gene in the plasmid vector map.
PVT22598 pBluescriptR-BSDC1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-BSDC1 plasmid. The pBluescriptR promotor is combined with a BSDC1 vector sequence and a  gene in the plasmid vector map.
PVT22599 pBluescriptR-HIC2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-HIC2 plasmid. The pBluescriptR promotor is combined with a HIC2 vector sequence and a  gene in the plasmid vector map.
PVT22600 pBluescriptR-SUDS3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SUDS3 plasmid. The pBluescriptR promotor is combined with a SUDS3 vector sequence and a  gene in the plasmid vector map.
PVT22601 pBluescriptR-ATXN3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-ATXN3 plasmid. The pBluescriptR promotor is combined with a ATXN3 vector sequence and a  gene in the plasmid vector map.
PVT22602 pBluescriptR-MAN2B2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MAN2B2 plasmid. The pBluescriptR promotor is combined with a MAN2B2 vector sequence and a  gene in the plasmid vector map.
PVT22603 pBluescriptR-TSPAN14 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TSPAN14 plasmid. The pBluescriptR promotor is combined with a TSPAN14 vector sequence and a  gene in the plasmid vector map.
PVT22604 pBluescriptR-JAG1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-JAG1 plasmid. The pBluescriptR promotor is combined with a JAG1 vector sequence and a  gene in the plasmid vector map.
PVT22605 pBluescriptR-IDH1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-IDH1 plasmid. The pBluescriptR promotor is combined with a IDH1 vector sequence and a  gene in the plasmid vector map.
PVT22606 pBluescriptR-GABRE Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-GABRE plasmid. The pBluescriptR promotor is combined with a GABRE vector sequence and a  gene in the plasmid vector map.
PVT22607 pBluescriptR-C6orf120 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-C6orf120 plasmid. The pBluescriptR promotor is combined with a C6orf120 vector sequence and a  gene in the plasmid vector map.
PVT22608 pBluescriptR-DNAI2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-DNAI2 plasmid. The pBluescriptR promotor is combined with a DNAI2 vector sequence and a  gene in the plasmid vector map.
PVT22609 pBluescriptR-DIS3L2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-DIS3L2 plasmid. The pBluescriptR promotor is combined with a DIS3L2 vector sequence and a  gene in the plasmid vector map.
PVT22610 pBluescriptR-PLAT Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-PLAT plasmid. The pBluescriptR promotor is combined with a PLAT vector sequence and a  gene in the plasmid vector map.
PVT22611 pBluescriptR-MPP5 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MPP5 plasmid. The pBluescriptR promotor is combined with a MPP5 vector sequence and a  gene in the plasmid vector map.
PVT22612 pBluescriptR-MORN4 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MORN4 plasmid. The pBluescriptR promotor is combined with a MORN4 vector sequence and a  gene in the plasmid vector map.
PVT22613 pBluescriptR-TMEM205 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-TMEM205 plasmid. The pBluescriptR promotor is combined with a TMEM205 vector sequence and a  gene in the plasmid vector map.
PVT22614 pBluescriptR-CDK5R2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-CDK5R2 plasmid. The pBluescriptR promotor is combined with a CDK5R2 vector sequence and a  gene in the plasmid vector map.
PVT22615 pBluescriptR-SPIN3 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-SPIN3 plasmid. The pBluescriptR promotor is combined with a SPIN3 vector sequence and a  gene in the plasmid vector map.
PVT22616 pBluescriptR-YPEL1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-YPEL1 plasmid. The pBluescriptR promotor is combined with a YPEL1 vector sequence and a  gene in the plasmid vector map.
PVT22617 pBluescriptR-IQUB Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-IQUB plasmid. The pBluescriptR promotor is combined with a IQUB vector sequence and a  gene in the plasmid vector map.
PVT22618 pBluescriptR-HEBP2 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-HEBP2 plasmid. The pBluescriptR promotor is combined with a HEBP2 vector sequence and a  gene in the plasmid vector map.
PVT22619 pBluescriptR-STAU1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-STAU1 plasmid. The pBluescriptR promotor is combined with a STAU1 vector sequence and a  gene in the plasmid vector map.
PVT22620 pBluescriptR-RASL10A Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-RASL10A plasmid. The pBluescriptR promotor is combined with a RASL10A vector sequence and a  gene in the plasmid vector map.
PVT22621 pBluescriptR-MLLT11 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-MLLT11 plasmid. The pBluescriptR promotor is combined with a MLLT11 vector sequence and a  gene in the plasmid vector map.
PVT22622 pBluescriptR-FIP1L1 Gentaur supplies 2ug of lyophilized Bluescri Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pBluescriptR-FIP1L1 plasmid. The pBluescriptR promotor is combined with a FIP1L1 vector sequence and a  gene in the plasmid vector map.
PVT22623 pCMV-SPORT6-ARGLU1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARGLU1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARGLU1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARGLU1 gene in the plasmid vector map.
PVT22624 pCMV-SPORT6-HERC2P9 Gentaur supplies 2ug of lyophilized CMV-SPORT6-HERC2P9 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HERC2P9 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HERC2P9 gene in the plasmid vector map.
PVT22625 pCMV-SPORT6-NR1H2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NR1H2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NR1H2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NR1H2 gene in the plasmid vector map.
PVT22626 pCMV-SPORT6-KATNA1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-KATNA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KATNA1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KATNA1 gene in the plasmid vector map.
PVT22627 pCMV-SPORT6-DDX11 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DDX11 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DDX11 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DDX11 gene in the plasmid vector map.
PVT22628 pCMV-SPORT6-SMIM29 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SMIM29 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SMIM29 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SMIM29 gene in the plasmid vector map.
PVT22629 pCMV-SPORT6-ADAMTSL2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ADAMTSL2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ADAMTSL2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ADAMTSL2 gene in the plasmid vector map.
PVT22630 pCMV-SPORT6-CYB561A3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CYB561A3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CYB561A3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CYB561A3 gene in the plasmid vector map.
PVT22631 pCMV-SPORT6-RMND5A Gentaur supplies 2ug of lyophilized CMV-SPORT6-RMND5A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RMND5A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RMND5A gene in the plasmid vector map.
PVT22632 pCMV-SPORT6-ZNF322 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF322 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF322 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF322 gene in the plasmid vector map.
PVT22633 pCMV-SPORT6-HOXC4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-HOXC4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HOXC4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HOXC4 gene in the plasmid vector map.
PVT22634 pCMV-SPORT6-PSMA4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PSMA4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PSMA4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PSMA4 gene in the plasmid vector map.
PVT22635 pCMV-SPORT6-TSEN54 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TSEN54 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TSEN54 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TSEN54 gene in the plasmid vector map.
PVT22636 pCMV-SPORT6-PILRB Gentaur supplies 2ug of lyophilized CMV-SPORT6-PILRB Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PILRB plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PILRB gene in the plasmid vector map.
PVT22637 pCMV-SPORT6-RAD21 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RAD21 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RAD21 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RAD21 gene in the plasmid vector map.
PVT22638 pCMV-SPORT6-TAX1BP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TAX1BP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TAX1BP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TAX1BP1 gene in the plasmid vector map.
PVT22639 pCMV-SPORT6-CYB561D2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CYB561D2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CYB561D2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CYB561D2 gene in the plasmid vector map.
PVT22640 pCMV-SPORT6-ZBED5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZBED5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZBED5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZBED5 gene in the plasmid vector map.
PVT22641 pCMV-SPORT6-F10 Gentaur supplies 2ug of lyophilized CMV-SPORT6-F10 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-F10 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a F10 gene in the plasmid vector map.
PVT22642 pCMV-SPORT6-UBOX5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-UBOX5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-UBOX5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a UBOX5 gene in the plasmid vector map.
PVT22643 pCMV-SPORT6-ZNF554 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF554 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF554 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF554 gene in the plasmid vector map.
PVT22644 pCMV-SPORT6-CROCCP2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CROCCP2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CROCCP2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CROCCP2 gene in the plasmid vector map.
PVT22645 pCMV-SPORT6-MTFP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MTFP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MTFP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MTFP1 gene in the plasmid vector map.
PVT22646 pCMV-SPORT6-BLCAP Gentaur supplies 2ug of lyophilized CMV-SPORT6-BLCAP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-BLCAP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a BLCAP gene in the plasmid vector map.
PVT22647 pCMV-SPORT6-BMPR1B Gentaur supplies 2ug of lyophilized CMV-SPORT6-BMPR1B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-BMPR1B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a BMPR1B gene in the plasmid vector map.
PVT22648 pCMV-SPORT6-TBC1D7 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TBC1D7 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TBC1D7 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TBC1D7 gene in the plasmid vector map.
PVT22649 pCMV-SPORT6-GLRX5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GLRX5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GLRX5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GLRX5 gene in the plasmid vector map.
PVT22650 pCMV-SPORT6-SHOC2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SHOC2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SHOC2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SHOC2 gene in the plasmid vector map.
PVT22651 pCMV-SPORT6-FAM131B Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM131B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM131B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM131B gene in the plasmid vector map.
PVT22652 pCMV-SPORT6-TRDMT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TRDMT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TRDMT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TRDMT1 gene in the plasmid vector map.
PVT22653 pCMV-SPORT6-KCNK12 Gentaur supplies 2ug of lyophilized CMV-SPORT6-KCNK12 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KCNK12 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KCNK12 gene in the plasmid vector map.
PVT22654 pCMV-SPORT6-SFI1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SFI1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SFI1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SFI1 gene in the plasmid vector map.
PVT22655 pCMV-SPORT6-CHPT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CHPT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CHPT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CHPT1 gene in the plasmid vector map.
PVT22656 pCMV-SPORT6-HINT2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-HINT2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HINT2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HINT2 gene in the plasmid vector map.
PVT22657 pCMV-SPORT6-QPCT Gentaur supplies 2ug of lyophilized CMV-SPORT6-QPCT Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-QPCT plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a QPCT gene in the plasmid vector map.
PVT22658 pCMV-SPORT6-SKAP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SKAP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SKAP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SKAP1 gene in the plasmid vector map.
PVT22659 pCMV-SPORT6-ADSSL1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ADSSL1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ADSSL1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ADSSL1 gene in the plasmid vector map.
PVT22660 pCMV-SPORT6-PCYOX1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PCYOX1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PCYOX1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PCYOX1 gene in the plasmid vector map.
PVT22661 pCMV-SPORT6-NBAS Gentaur supplies 2ug of lyophilized CMV-SPORT6-NBAS Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NBAS plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NBAS gene in the plasmid vector map.
PVT22662 pCMV-SPORT6-NPIPA8 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NPIPA8 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NPIPA8 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NPIPA8 gene in the plasmid vector map.
PVT22663 pCMV-SPORT6-NDUFS6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NDUFS6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NDUFS6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NDUFS6 gene in the plasmid vector map.
PVT22664 pCMV-SPORT6-APBB1IP Gentaur supplies 2ug of lyophilized CMV-SPORT6-APBB1IP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-APBB1IP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a APBB1IP gene in the plasmid vector map.
PVT22665 pCMV-SPORT6-ZNF410 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF410 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF410 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF410 gene in the plasmid vector map.
PVT22666 pCMV-SPORT6-RFPL2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RFPL2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RFPL2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RFPL2 gene in the plasmid vector map.
PVT22667 pCMV-SPORT6-KIF4A Gentaur supplies 2ug of lyophilized CMV-SPORT6-KIF4A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KIF4A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KIF4A gene in the plasmid vector map.
PVT22668 pCMV-SPORT6-WFDC2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-WFDC2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-WFDC2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a WFDC2 gene in the plasmid vector map.
PVT22669 pCMV-SPORT6-FAM8A1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM8A1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM8A1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM8A1 gene in the plasmid vector map.
PVT22670 pCMV-SPORT6-LDHD Gentaur supplies 2ug of lyophilized CMV-SPORT6-LDHD Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LDHD plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LDHD gene in the plasmid vector map.
PVT22671 pCMV-SPORT6-VBP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-VBP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-VBP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a VBP1 gene in the plasmid vector map.
PVT22672 pCMV-SPORT6-NICN1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NICN1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NICN1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NICN1 gene in the plasmid vector map.
PVT22673 pCMV-SPORT6-LAMP5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LAMP5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LAMP5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LAMP5 gene in the plasmid vector map.
PVT22674 pCMV-SPORT6-GALNAC4S-6ST Gentaur supplies 2ug of lyophilized CMV-SPORT6-GALNAC4S-6ST Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GALNAC4S-6ST plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GALNAC4S gene in the plasmid vector map.
PVT22675 pCMV-SPORT6-SNX17 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SNX17 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SNX17 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SNX17 gene in the plasmid vector map.
PVT22676 pCMV-SPORT6-ACTN2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ACTN2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ACTN2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ACTN2 gene in the plasmid vector map.
PVT22677 pCMV-SPORT6-FAM53C Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM53C Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM53C plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM53C gene in the plasmid vector map.
PVT22678 pCMV-SPORT6-C17orf82 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C17orf82 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C17orf82 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C17orf82 gene in the plasmid vector map.
PVT22679 pCMV-SPORT6-PON2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PON2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PON2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PON2 gene in the plasmid vector map.
PVT22680 pCMV-SPORT6-NUP62 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NUP62 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NUP62 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NUP62 gene in the plasmid vector map.
PVT22681 pCMV-SPORT6-TOM1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TOM1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TOM1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TOM1 gene in the plasmid vector map.
PVT22682 pCMV-SPORT6-ANKRD36 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ANKRD36 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ANKRD36 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ANKRD36 gene in the plasmid vector map.
PVT22683 pCMV-SPORT6-ARPP21 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARPP21 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARPP21 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARPP21 gene in the plasmid vector map.
PVT22684 pCMV-SPORT6-LIMD2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LIMD2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LIMD2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LIMD2 gene in the plasmid vector map.
PVT22685 pCMV-SPORT6-RPAIN-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPAIN-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPAIN-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPAIN gene in the plasmid vector map.
PVT22686 pCMV-SPORT6-FAM72B Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM72B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM72B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM72B gene in the plasmid vector map.
PVT22687 pCMV-SPORT6-SELENOP Gentaur supplies 2ug of lyophilized CMV-SPORT6-SELENOP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SELENOP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SELENOP gene in the plasmid vector map.
PVT22688 pCMV-SPORT6-PRR14 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PRR14 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PRR14 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PRR14 gene in the plasmid vector map.
PVT22689 pCMV-SPORT6-KCNMB4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-KCNMB4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KCNMB4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KCNMB4 gene in the plasmid vector map.
PVT22690 pCMV-SPORT6-BRD7 Gentaur supplies 2ug of lyophilized CMV-SPORT6-BRD7 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-BRD7 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a BRD7 gene in the plasmid vector map.
PVT22691 pCMV-SPORT6-PPME1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PPME1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PPME1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PPME1 gene in the plasmid vector map.
PVT22692 pCMV-SPORT6-SERTAD3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SERTAD3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SERTAD3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SERTAD3 gene in the plasmid vector map.
PVT22693 pCMV-SPORT6-SMAD3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SMAD3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SMAD3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SMAD3 gene in the plasmid vector map.
PVT22694 pCMV-SPORT6-KLK3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-KLK3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KLK3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KLK3 gene in the plasmid vector map.
PVT22695 pCMV-SPORT6-POLK Gentaur supplies 2ug of lyophilized CMV-SPORT6-POLK Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-POLK plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a POLK gene in the plasmid vector map.
PVT22696 pCMV-SPORT6-PEMT Gentaur supplies 2ug of lyophilized CMV-SPORT6-PEMT Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PEMT plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PEMT gene in the plasmid vector map.
PVT22697 pCMV-SPORT6-ASCC3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ASCC3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ASCC3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ASCC3 gene in the plasmid vector map.
PVT22698 pCMV-SPORT6-PHF20L1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PHF20L1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PHF20L1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PHF20L1 gene in the plasmid vector map.
PVT22699 pCMV-SPORT6-C1QTNF2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C1QTNF2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C1QTNF2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C1QTNF2 gene in the plasmid vector map.
PVT22700 pCMV-SPORT6-EHD4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EHD4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EHD4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EHD4 gene in the plasmid vector map.
PVT22701 pCMV-SPORT6-PCED1A Gentaur supplies 2ug of lyophilized CMV-SPORT6-PCED1A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PCED1A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PCED1A gene in the plasmid vector map.
PVT22702 pCMV-SPORT6-F2R Gentaur supplies 2ug of lyophilized CMV-SPORT6-F2R Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-F2R plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a F2R gene in the plasmid vector map.
PVT22703 pCMV-SPORT6-ZBTB1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZBTB1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZBTB1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZBTB1 gene in the plasmid vector map.
PVT22704 pCMV-SPORT6-NUDT10 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NUDT10 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NUDT10 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NUDT10 gene in the plasmid vector map.
PVT22705 pCMV-SPORT6-EIF4EBP2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EIF4EBP2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EIF4EBP2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EIF4EBP2 gene in the plasmid vector map.
PVT22706 pCMV-SPORT6-CRELD2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CRELD2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CRELD2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CRELD2 gene in the plasmid vector map.
PVT22707 pCMV-SPORT6-UBE2K Gentaur supplies 2ug of lyophilized CMV-SPORT6-UBE2K Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-UBE2K plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a UBE2K gene in the plasmid vector map.
PVT22708 pCMV-SPORT6-NELFE Gentaur supplies 2ug of lyophilized CMV-SPORT6-NELFE Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NELFE plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NELFE gene in the plasmid vector map.
PVT22709 pCMV-SPORT6-NTM Gentaur supplies 2ug of lyophilized CMV-SPORT6-NTM Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NTM plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NTM gene in the plasmid vector map.
PVT22710 pCMV-SPORT6-P2RY10 Gentaur supplies 2ug of lyophilized CMV-SPORT6-P2RY10 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-P2RY10 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a P2RY10 gene in the plasmid vector map.
PVT22711 pCMV-SPORT6-TPRA1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TPRA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TPRA1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TPRA1 gene in the plasmid vector map.
PVT22712 pCMV-SPORT6-PLEKHB2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PLEKHB2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PLEKHB2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PLEKHB2 gene in the plasmid vector map.
PVT22713 pCMV-SPORT6-ZCCHC17 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZCCHC17 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZCCHC17 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZCCHC17 gene in the plasmid vector map.
PVT22714 pCMV-SPORT6-ARHGEF16 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARHGEF16 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARHGEF16 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARHGEF16 gene in the plasmid vector map.
PVT22715 pCMV-SPORT6-CPEB1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CPEB1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CPEB1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CPEB1 gene in the plasmid vector map.
PVT22716 pCMV-SPORT6-DEXI Gentaur supplies 2ug of lyophilized CMV-SPORT6-DEXI Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DEXI plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DEXI gene in the plasmid vector map.
PVT22717 pCMV-SPORT6-H3C6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-H3C6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-H3C6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a H3C6 gene in the plasmid vector map.
PVT22718 pCMV-SPORT6-PIBF1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PIBF1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PIBF1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PIBF1 gene in the plasmid vector map.
PVT22719 pCMV-SPORT6-PBDC1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PBDC1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PBDC1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PBDC1 gene in the plasmid vector map.
PVT22720 pCMV-SPORT6-RPL12 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPL12 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPL12 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPL12 gene in the plasmid vector map.
PVT22721 pCMV-SPORT6-RING1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RING1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RING1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RING1 gene in the plasmid vector map.
PVT22722 pCMV-SPORT6-TNFRSF1B Gentaur supplies 2ug of lyophilized CMV-SPORT6-TNFRSF1B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TNFRSF1B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TNFRSF1B gene in the plasmid vector map.
PVT22723 pCMV-SPORT6-SPATA2L Gentaur supplies 2ug of lyophilized CMV-SPORT6-SPATA2L Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SPATA2L plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SPATA2L gene in the plasmid vector map.
PVT22724 pCMV-SPORT6-FRMD5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FRMD5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FRMD5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FRMD5 gene in the plasmid vector map.
PVT22725 pCMV-SPORT6-CLK2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CLK2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CLK2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CLK2 gene in the plasmid vector map.
PVT22726 pCMV-SPORT6-CPNE5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CPNE5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CPNE5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CPNE5 gene in the plasmid vector map.
PVT22727 pCMV-SPORT6-LCOR Gentaur supplies 2ug of lyophilized CMV-SPORT6-LCOR Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LCOR plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LCOR gene in the plasmid vector map.
PVT22728 pCMV-SPORT6-NOP14 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NOP14 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NOP14 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NOP14 gene in the plasmid vector map.
PVT22729 pCMV-SPORT6-MRPL43 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MRPL43 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MRPL43 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MRPL43 gene in the plasmid vector map.
PVT22730 pCMV-SPORT6-SPATC1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SPATC1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SPATC1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SPATC1 gene in the plasmid vector map.
PVT22731 pCMV-SPORT6-SLC9A3R1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SLC9A3R1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SLC9A3R1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SLC9A3R1 gene in the plasmid vector map.
PVT22732 pCMV-SPORT6-FAM161B Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM161B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM161B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM161B gene in the plasmid vector map.
PVT22733 pCMV-SPORT6-CMC1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CMC1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CMC1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CMC1 gene in the plasmid vector map.
PVT22734 pCMV-SPORT6-MFAP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MFAP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MFAP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MFAP1 gene in the plasmid vector map.
PVT22735 pCMV-SPORT6-BCL10 Gentaur supplies 2ug of lyophilized CMV-SPORT6-BCL10 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-BCL10 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a BCL10 gene in the plasmid vector map.
PVT22736 pCMV-SPORT6-TMED4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TMED4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TMED4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TMED4 gene in the plasmid vector map.
PVT22737 pCMV-SPORT6-COTL1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-COTL1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-COTL1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a COTL1 gene in the plasmid vector map.
PVT22738 pCMV-SPORT6-MYBL2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MYBL2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MYBL2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MYBL2 gene in the plasmid vector map.
PVT22739 pCMV-SPORT6-PIK3C3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PIK3C3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PIK3C3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PIK3C3 gene in the plasmid vector map.
PVT22740 pCMV-SPORT6-THBD Gentaur supplies 2ug of lyophilized CMV-SPORT6-THBD Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-THBD plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a THBD gene in the plasmid vector map.
PVT22741 pCMV-SPORT6-LRRFIP2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LRRFIP2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LRRFIP2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LRRFIP2 gene in the plasmid vector map.
PVT22742 pCMV-SPORT6-GPATCH4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GPATCH4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GPATCH4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GPATCH4 gene in the plasmid vector map.
PVT22743 pCMV-SPORT6-RPSAP58 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPSAP58 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPSAP58 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPSAP58 gene in the plasmid vector map.
PVT22744 pCMV-SPORT6-ARHGAP30 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARHGAP30 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARHGAP30 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARHGAP30 gene in the plasmid vector map.
PVT22745 pCMV-SPORT6-ZNF384 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF384 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF384 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF384 gene in the plasmid vector map.
PVT22746 pCMV-SPORT6-RGS19 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RGS19 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RGS19 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RGS19 gene in the plasmid vector map.
PVT22747 pCMV-SPORT6-NSMCE3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NSMCE3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NSMCE3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NSMCE3 gene in the plasmid vector map.
PVT22748 pCMV-SPORT6-EDIL3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EDIL3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EDIL3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EDIL3 gene in the plasmid vector map.
PVT22749 pCMV-SPORT6-SNRNP35 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SNRNP35 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SNRNP35 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SNRNP35 gene in the plasmid vector map.
PVT22750 pCMV-SPORT6-PHYHD1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PHYHD1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PHYHD1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PHYHD1 gene in the plasmid vector map.
PVT22751 pCMV-SPORT6-MTA2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MTA2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MTA2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MTA2 gene in the plasmid vector map.
PVT22752 pCMV-SPORT6-PNPT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PNPT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PNPT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PNPT1 gene in the plasmid vector map.
PVT22753 pCMV-SPORT6-RECQL5-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RECQL5-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RECQL5-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RECQL5 gene in the plasmid vector map.
PVT22754 pCMV-SPORT6-ZNF394 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF394 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF394 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF394 gene in the plasmid vector map.
PVT22755 pCMV-SPORT6-RIPK3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RIPK3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RIPK3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RIPK3 gene in the plasmid vector map.
PVT22756 pCMV-SPORT6-DYNC1H1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DYNC1H1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DYNC1H1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DYNC1H1 gene in the plasmid vector map.
PVT22757 pCMV-SPORT6-ADORA3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ADORA3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ADORA3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ADORA3 gene in the plasmid vector map.
PVT22758 pCMV-SPORT6-ENDOV Gentaur supplies 2ug of lyophilized CMV-SPORT6-ENDOV Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ENDOV plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ENDOV gene in the plasmid vector map.
PVT22759 pCMV-SPORT6-CSAG1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CSAG1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CSAG1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CSAG1 gene in the plasmid vector map.
PVT22760 pCMV-SPORT6-KHDC4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-KHDC4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KHDC4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KHDC4 gene in the plasmid vector map.
PVT22761 pCMV-SPORT6-C14orf119 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C14orf119 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C14orf119 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C14orf119 gene in the plasmid vector map.
PVT22762 pCMV-SPORT6-MED27 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MED27 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MED27 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MED27 gene in the plasmid vector map.
PVT22763 pCMV-SPORT6-NOB1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NOB1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NOB1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NOB1 gene in the plasmid vector map.
PVT22764 pCMV-SPORT6-CASC4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CASC4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CASC4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CASC4 gene in the plasmid vector map.
PVT22765 pCMV-SPORT6-TYW5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TYW5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TYW5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TYW5 gene in the plasmid vector map.
PVT22766 pCMV-SPORT6-FAM122C Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM122C Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM122C plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM122C gene in the plasmid vector map.
PVT22767 pCMV-SPORT6-SLC37A4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SLC37A4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SLC37A4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SLC37A4 gene in the plasmid vector map.
PVT22768 pCMV-SPORT6-PFDN6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PFDN6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PFDN6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PFDN6 gene in the plasmid vector map.
PVT22769 pCMV-SPORT6-PM20D1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PM20D1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PM20D1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PM20D1 gene in the plasmid vector map.
PVT22770 pCMV-SPORT6-SGK2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SGK2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SGK2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SGK2 gene in the plasmid vector map.
PVT22771 pCMV-SPORT6-ZRANB3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZRANB3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZRANB3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZRANB3 gene in the plasmid vector map.
PVT22772 pCMV-SPORT6-GCFC2-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GCFC2-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GCFC2-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GCFC2 gene in the plasmid vector map.
PVT22773 pCMV-SPORT6-PRH1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PRH1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PRH1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PRH1 gene in the plasmid vector map.
PVT22774 pCMV-SPORT6-ELF2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ELF2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ELF2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ELF2 gene in the plasmid vector map.
PVT22775 pCMV-SPORT6-RSRP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RSRP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RSRP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RSRP1 gene in the plasmid vector map.
PVT22776 pCMV-SPORT6-TATDN1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TATDN1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TATDN1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TATDN1 gene in the plasmid vector map.
PVT22777 pCMV-SPORT6-ST3GAL5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ST3GAL5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ST3GAL5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ST3GAL5 gene in the plasmid vector map.
PVT22778 pCMV-SPORT6-GORAB Gentaur supplies 2ug of lyophilized CMV-SPORT6-GORAB Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GORAB plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GORAB gene in the plasmid vector map.
PVT22779 pCMV-SPORT6-SMPD4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SMPD4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SMPD4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SMPD4 gene in the plasmid vector map.
PVT22780 pCMV-SPORT6-VEZT Gentaur supplies 2ug of lyophilized CMV-SPORT6-VEZT Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-VEZT plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a VEZT gene in the plasmid vector map.
PVT22781 pCMV-SPORT6-VANGL1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-VANGL1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-VANGL1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a VANGL1 gene in the plasmid vector map.
PVT22782 pCMV-SPORT6-STAMBP Gentaur supplies 2ug of lyophilized CMV-SPORT6-STAMBP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-STAMBP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a STAMBP gene in the plasmid vector map.
PVT22783 pCMV-SPORT6-EOLA1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EOLA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EOLA1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EOLA1 gene in the plasmid vector map.
PVT22784 pCMV-SPORT6-ASRGL1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ASRGL1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ASRGL1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ASRGL1 gene in the plasmid vector map.
PVT22785 pCMV-SPORT6-DCAF11 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DCAF11 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DCAF11 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DCAF11 gene in the plasmid vector map.
PVT22786 pCMV-SPORT6-CDC73 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CDC73 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CDC73 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CDC73 gene in the plasmid vector map.
PVT22787 pCMV-SPORT6-THY1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-THY1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-THY1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a THY1 gene in the plasmid vector map.
PVT22788 pCMV-SPORT6-GTF2H3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GTF2H3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GTF2H3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GTF2H3 gene in the plasmid vector map.
PVT22789 pCMV-SPORT6-EXD3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EXD3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EXD3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EXD3 gene in the plasmid vector map.
PVT22790 pCMV-SPORT6-RDH10 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RDH10 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RDH10 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RDH10 gene in the plasmid vector map.
PVT22791 pCMV-SPORT6-RBPJ Gentaur supplies 2ug of lyophilized CMV-SPORT6-RBPJ Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RBPJ plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RBPJ gene in the plasmid vector map.
PVT22792 pCMV-SPORT6-ELN Gentaur supplies 2ug of lyophilized CMV-SPORT6-ELN Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ELN plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ELN gene in the plasmid vector map.
PVT22793 pCMV-SPORT6-MRPS27 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MRPS27 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MRPS27 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MRPS27 gene in the plasmid vector map.
PVT22794 pCMV-SPORT6-HSPA14 Gentaur supplies 2ug of lyophilized CMV-SPORT6-HSPA14 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HSPA14 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HSPA14 gene in the plasmid vector map.
PVT22795 pCMV-SPORT6-CDKN3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CDKN3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CDKN3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CDKN3 gene in the plasmid vector map.
PVT22796 pCMV-SPORT6-THEM4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-THEM4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-THEM4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a THEM4 gene in the plasmid vector map.
PVT22797 pCMV-SPORT6-NFS1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NFS1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NFS1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NFS1 gene in the plasmid vector map.
PVT22798 pCMV-SPORT6-DGLUCY Gentaur supplies 2ug of lyophilized CMV-SPORT6-DGLUCY Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DGLUCY plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DGLUCY gene in the plasmid vector map.
PVT22799 pCMV-SPORT6-REEP5 Gentaur supplies 2ug of lyophilized CMV-SPORT6-REEP5 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-REEP5 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a REEP5 gene in the plasmid vector map.
PVT22800 pCMV-SPORT6-WDR92 Gentaur supplies 2ug of lyophilized CMV-SPORT6-WDR92 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-WDR92 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a WDR92 gene in the plasmid vector map.
PVT22801 pCMV-SPORT6-THOC7 Gentaur supplies 2ug of lyophilized CMV-SPORT6-THOC7 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-THOC7 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a THOC7 gene in the plasmid vector map.
PVT22802 pCMV-SPORT6-ARHGAP28 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARHGAP28 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARHGAP28 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARHGAP28 gene in the plasmid vector map.
PVT22803 pCMV-SPORT6-TULP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TULP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TULP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TULP1 gene in the plasmid vector map.
PVT22804 pCMV-SPORT6-TMEM60 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TMEM60 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TMEM60 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TMEM60 gene in the plasmid vector map.
PVT22805 pCMV-SPORT6-PIGO Gentaur supplies 2ug of lyophilized CMV-SPORT6-PIGO Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PIGO plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PIGO gene in the plasmid vector map.
PVT22806 pCMV-SPORT6-SCLT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SCLT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SCLT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SCLT1 gene in the plasmid vector map.
PVT22807 pCMV-SPORT6-CHMP1B Gentaur supplies 2ug of lyophilized CMV-SPORT6-CHMP1B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CHMP1B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CHMP1B gene in the plasmid vector map.
PVT22808 pCMV-SPORT6-MDH1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MDH1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MDH1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MDH1 gene in the plasmid vector map.
PVT22809 pCMV-SPORT6-SPATA20 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SPATA20 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SPATA20 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SPATA20 gene in the plasmid vector map.
PVT22810 pCMV-SPORT6-HSCB Gentaur supplies 2ug of lyophilized CMV-SPORT6-HSCB Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HSCB plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HSCB gene in the plasmid vector map.
PVT22811 pCMV-SPORT6-CNPY2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CNPY2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CNPY2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CNPY2 gene in the plasmid vector map.
PVT22812 pCMV-SPORT6-PSMG3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PSMG3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PSMG3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PSMG3 gene in the plasmid vector map.
PVT22813 pCMV-SPORT6-CCDC6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CCDC6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CCDC6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CCDC6 gene in the plasmid vector map.
PVT22814 pCMV-SPORT6-C11orf57 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C11orf57 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C11orf57 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C11orf57 gene in the plasmid vector map.
PVT22815 pCMV-SPORT6-LMAN2L Gentaur supplies 2ug of lyophilized CMV-SPORT6-LMAN2L Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LMAN2L plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LMAN2L gene in the plasmid vector map.
PVT22816 pCMV-SPORT6-IP6K2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-IP6K2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-IP6K2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a IP6K2 gene in the plasmid vector map.
PVT22817 pCMV-SPORT6-GPR143 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GPR143 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GPR143 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GPR143 gene in the plasmid vector map.
PVT22818 pCMV-SPORT6-CD244 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CD244 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CD244 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CD244 gene in the plasmid vector map.
PVT22819 pCMV-SPORT6-C9orf114-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C9orf114-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C9orf114-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C9orf114 gene in the plasmid vector map.
PVT22820 pCMV-SPORT6-ORMDL3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ORMDL3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ORMDL3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ORMDL3 gene in the plasmid vector map.
PVT22821 pCMV-SPORT6-MYO1C Gentaur supplies 2ug of lyophilized CMV-SPORT6-MYO1C Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MYO1C plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MYO1C gene in the plasmid vector map.
PVT22822 pCMV-SPORT6-DPM2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DPM2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DPM2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DPM2 gene in the plasmid vector map.
PVT22823 pCMV-SPORT6-FAM104B Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM104B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM104B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM104B gene in the plasmid vector map.
PVT22824 pCMV-SPORT6-ERLEC1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ERLEC1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ERLEC1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ERLEC1 gene in the plasmid vector map.
PVT22825 pCMV-SPORT6-CDCA7L Gentaur supplies 2ug of lyophilized CMV-SPORT6-CDCA7L Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CDCA7L plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CDCA7L gene in the plasmid vector map.
PVT22826 pCMV-SPORT6-MED20 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MED20 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MED20 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MED20 gene in the plasmid vector map.
PVT22827 pCMV-SPORT6-POMT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-POMT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-POMT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a POMT1 gene in the plasmid vector map.
PVT22828 pCMV-SPORT6-HBM Gentaur supplies 2ug of lyophilized CMV-SPORT6-HBM Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HBM plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HBM gene in the plasmid vector map.
PVT22829 pCMV-SPORT6-FANCL Gentaur supplies 2ug of lyophilized CMV-SPORT6-FANCL Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FANCL plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FANCL gene in the plasmid vector map.
PVT22830 pCMV-SPORT6-MICOS13 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MICOS13 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MICOS13 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MICOS13 gene in the plasmid vector map.
PVT22831 pCMV-SPORT6-MFSD1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MFSD1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MFSD1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MFSD1 gene in the plasmid vector map.
PVT22832 pCMV-SPORT6-C20orf85 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C20orf85 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C20orf85 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C20orf85 gene in the plasmid vector map.
PVT22833 pCMV-SPORT6-ATP5F1A Gentaur supplies 2ug of lyophilized CMV-SPORT6-ATP5F1A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ATP5F1A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ATP5F1A gene in the plasmid vector map.
PVT22834 pCMV-SPORT6-GBP3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GBP3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GBP3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GBP3 gene in the plasmid vector map.
PVT22835 pCMV-SPORT6-PELP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PELP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PELP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PELP1 gene in the plasmid vector map.
PVT22836 pCMV-SPORT6-ZNF658 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF658 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF658 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF658 gene in the plasmid vector map.
PVT22837 pCMV-SPORT6-CLEC10A Gentaur supplies 2ug of lyophilized CMV-SPORT6-CLEC10A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CLEC10A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CLEC10A gene in the plasmid vector map.
PVT22838 pCMV-SPORT6-KLF1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-KLF1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-KLF1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a KLF1 gene in the plasmid vector map.
PVT22839 pCMV-SPORT6-ARMC8-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARMC8-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARMC8-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARMC8 gene in the plasmid vector map.
PVT22840 pCMV-SPORT6-NREP Gentaur supplies 2ug of lyophilized CMV-SPORT6-NREP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NREP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NREP gene in the plasmid vector map.
PVT22841 pCMV-SPORT6-MRPL2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MRPL2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MRPL2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MRPL2 gene in the plasmid vector map.
PVT22842 pCMV-SPORT6-WDFY4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-WDFY4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-WDFY4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a WDFY4 gene in the plasmid vector map.
PVT22843 pCMV-SPORT6-SAP30BP Gentaur supplies 2ug of lyophilized CMV-SPORT6-SAP30BP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SAP30BP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SAP30BP gene in the plasmid vector map.
PVT22844 pCMV-SPORT6-TAFA1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TAFA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TAFA1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TAFA1 gene in the plasmid vector map.
PVT22845 pCMV-SPORT6-DDX47 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DDX47 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DDX47 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DDX47 gene in the plasmid vector map.
PVT22846 pCMV-SPORT6-C19orf48 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C19orf48 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C19orf48 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C19orf48 gene in the plasmid vector map.
PVT22847 pCMV-SPORT6-PCMTD2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PCMTD2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PCMTD2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PCMTD2 gene in the plasmid vector map.
PVT22848 pCMV-SPORT6-GNB2-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GNB2-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GNB2-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GNB2 gene in the plasmid vector map.
PVT22849 pCMV-SPORT6-LIG3-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LIG3-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LIG3-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LIG3 gene in the plasmid vector map.
PVT22850 pCMV-SPORT6-LIG3-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LIG3-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LIG3-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LIG3 gene in the plasmid vector map.
PVT22851 pCMV-SPORT6-ARPC4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ARPC4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ARPC4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ARPC4 gene in the plasmid vector map.
PVT22852 pCMV-SPORT6-LOC23117 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LOC23117 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LOC23117 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LOC23117 gene in the plasmid vector map.
PVT22853 pCMV-SPORT6-MFAP4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MFAP4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MFAP4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MFAP4 gene in the plasmid vector map.
PVT22854 pCMV-SPORT6-PHIP Gentaur supplies 2ug of lyophilized CMV-SPORT6-PHIP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PHIP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PHIP gene in the plasmid vector map.
PVT22855 pCMV-SPORT6-EEF1A1-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EEF1A1-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EEF1A1-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EEF1A1 gene in the plasmid vector map.
PVT22856 pCMV-SPORT6-C19orf2-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C19orf2-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C19orf2-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C19orf2 gene in the plasmid vector map.
PVT22857 pCMV-SPORT6-ZNF585A Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF585A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF585A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF585A gene in the plasmid vector map.
PVT22858 pCMV-SPORT6-EGFLAM-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EGFLAM-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EGFLAM-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EGFLAM gene in the plasmid vector map.
PVT22859 pCMV-SPORT6-DNM1( Gentaur supplies 2ug of lyophilized CMV-SPORT6-DNM1( Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DNM1( plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DNM1( gene in the plasmid vector map.
PVT22860 pCMV-SPORT6-TMEM81 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TMEM81 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TMEM81 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TMEM81 gene in the plasmid vector map.
PVT22861 pCMV-SPORT6-CCNYL1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CCNYL1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CCNYL1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CCNYL1 gene in the plasmid vector map.
PVT22862 pCMV-SPORT6-C7 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C7 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C7 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C7 gene in the plasmid vector map.
PVT22863 pCMV-SPORT6-EXOC4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EXOC4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EXOC4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EXOC4 gene in the plasmid vector map.
PVT22864 pCMV-SPORT6-SRRM3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SRRM3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SRRM3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SRRM3 gene in the plasmid vector map.
PVT22865 pCMV-SPORT6-UBQLN4 Gentaur supplies 2ug of lyophilized CMV-SPORT6-UBQLN4 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-UBQLN4 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a UBQLN4 gene in the plasmid vector map.
PVT22866 pCMV-SPORT6-LGALS7 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LGALS7 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LGALS7 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LGALS7 gene in the plasmid vector map.
PVT22867 pCMV-SPORT6-PPRC1-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PPRC1-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PPRC1-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PPRC1 gene in the plasmid vector map.
PVT22868 pCMV-SPORT6-STXBP6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-STXBP6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-STXBP6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a STXBP6 gene in the plasmid vector map.
PVT22869 pCMV-SPORT6-ALKBH3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ALKBH3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ALKBH3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ALKBH3 gene in the plasmid vector map.
PVT22870 pCMV-SPORT6-LRRC25 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LRRC25 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LRRC25 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LRRC25 gene in the plasmid vector map.
PVT22871 pCMV-SPORT6-ZNF774 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF774 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF774 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF774 gene in the plasmid vector map.
PVT22872 pCMV-SPORT6-PSIP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PSIP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PSIP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PSIP1 gene in the plasmid vector map.
PVT22873 pCMV-SPORT6-HDAC7-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-HDAC7-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HDAC7-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HDAC7 gene in the plasmid vector map.
PVT22874 pCMV-SPORT6-LIMS2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-LIMS2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LIMS2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LIMS2 gene in the plasmid vector map.
PVT22875 pCMV-SPORT6-MMRN1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MMRN1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MMRN1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MMRN1 gene in the plasmid vector map.
PVT22876 pCMV-SPORT6-RARA Gentaur supplies 2ug of lyophilized CMV-SPORT6-RARA Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RARA plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RARA gene in the plasmid vector map.
PVT22877 pCMV-SPORT6-HIST1H4I Gentaur supplies 2ug of lyophilized CMV-SPORT6-HIST1H4I Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HIST1H4I plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HIST1H4I gene in the plasmid vector map.
PVT22878 pCMV-SPORT6-SPRY1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-SPRY1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-SPRY1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a SPRY1 gene in the plasmid vector map.
PVT22879 pCMV-SPORT6-JOSD2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-JOSD2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-JOSD2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a JOSD2 gene in the plasmid vector map.
PVT22880 pCMV-SPORT6-RANBP9 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RANBP9 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RANBP9 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RANBP9 gene in the plasmid vector map.
PVT22881 pCMV-SPORT6-RMDN3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RMDN3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RMDN3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RMDN3 gene in the plasmid vector map.
PVT22882 pCMV-SPORT6-TCAIM-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TCAIM-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TCAIM-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TCAIM gene in the plasmid vector map.
PVT22883 pCMV-SPORT6-MPV17L Gentaur supplies 2ug of lyophilized CMV-SPORT6-MPV17L Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MPV17L plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MPV17L gene in the plasmid vector map.
PVT22884 pCMV-SPORT6-UBE2V2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-UBE2V2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-UBE2V2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a UBE2V2 gene in the plasmid vector map.
PVT22885 pCMV-SPORT6-CTNNA3-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CTNNA3-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CTNNA3-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CTNNA3 gene in the plasmid vector map.
PVT22886 pCMV-SPORT6-GTF2IRD2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-GTF2IRD2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-GTF2IRD2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a GTF2IRD2 gene in the plasmid vector map.
PVT22887 pCMV-SPORT6-NDUFA11 Gentaur supplies 2ug of lyophilized CMV-SPORT6-NDUFA11 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-NDUFA11 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a NDUFA11 gene in the plasmid vector map.
PVT22888 pCMV-SPORT6-VIT Gentaur supplies 2ug of lyophilized CMV-SPORT6-VIT Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-VIT plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a VIT gene in the plasmid vector map.
PVT22889 pCMV-SPORT6-ACAT1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ACAT1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ACAT1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ACAT1 gene in the plasmid vector map.
PVT22890 pCMV-SPORT6-PMAIP1-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-PMAIP1-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PMAIP1-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PMAIP1 gene in the plasmid vector map.
PVT22891 pCMV-SPORT6-USP39 Gentaur supplies 2ug of lyophilized CMV-SPORT6-USP39 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-USP39 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a USP39 gene in the plasmid vector map.
PVT22892 pCMV-SPORT6-ENOPH1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ENOPH1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ENOPH1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ENOPH1 gene in the plasmid vector map.
PVT22893 pCMV-SPORT6-BTNL9 Gentaur supplies 2ug of lyophilized CMV-SPORT6-BTNL9 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-BTNL9 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a BTNL9 gene in the plasmid vector map.
PVT22894 pCMV-SPORT6-ZNF581 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZNF581 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZNF581 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZNF581 gene in the plasmid vector map.
PVT22895 pCMV-SPORT6-OPN3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-OPN3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-OPN3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a OPN3 gene in the plasmid vector map.
PVT22896 pCMV-SPORT6-ISCA1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ISCA1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ISCA1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ISCA1 gene in the plasmid vector map.
PVT22897 pCMV-SPORT6-LGALS9C Gentaur supplies 2ug of lyophilized CMV-SPORT6-LGALS9C Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-LGALS9C plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a LGALS9C gene in the plasmid vector map.
PVT22898 pCMV-SPORT6-FAAH2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAAH2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAAH2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAAH2 gene in the plasmid vector map.
PVT22899 pCMV-SPORT6-ZADH2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZADH2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZADH2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZADH2 gene in the plasmid vector map.
PVT22900 pCMV-SPORT6-CLEC18A Gentaur supplies 2ug of lyophilized CMV-SPORT6-CLEC18A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CLEC18A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CLEC18A gene in the plasmid vector map.
PVT22901 pCMV-SPORT6-RPL7L1-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPL7L1-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPL7L1-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPL7L1 gene in the plasmid vector map.
PVT22902 pCMV-SPORT6-IGKC Gentaur supplies 2ug of lyophilized CMV-SPORT6-IGKC Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-IGKC plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a IGKC gene in the plasmid vector map.
PVT22903 pCMV-SPORT6-CYB5RL Gentaur supplies 2ug of lyophilized CMV-SPORT6-CYB5RL Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CYB5RL plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CYB5RL gene in the plasmid vector map.
PVT22904 pCMV-SPORT6-CHAD Gentaur supplies 2ug of lyophilized CMV-SPORT6-CHAD Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CHAD plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CHAD gene in the plasmid vector map.
PVT22905 pCMV-SPORT6-PHF5A Gentaur supplies 2ug of lyophilized CMV-SPORT6-PHF5A Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-PHF5A plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a PHF5A gene in the plasmid vector map.
PVT22906 pCMV-SPORT6-FRMPD2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FRMPD2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FRMPD2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FRMPD2 gene in the plasmid vector map.
PVT22907 pCMV-SPORT6-HLA-DRA Gentaur supplies 2ug of lyophilized CMV-SPORT6-HLA-DRA Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HLA-DRA plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HLA gene in the plasmid vector map.
PVT22908 pCMV-SPORT6-RPS3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-RPS3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RPS3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RPS3 gene in the plasmid vector map.
PVT22909 pCMV-SPORT6-ADAL Gentaur supplies 2ug of lyophilized CMV-SPORT6-ADAL Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ADAL plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ADAL gene in the plasmid vector map.
PVT22910 pCMV-SPORT6-CENPP Gentaur supplies 2ug of lyophilized CMV-SPORT6-CENPP Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CENPP plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CENPP gene in the plasmid vector map.
PVT22911 pCMV-SPORT6-CCNL2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CCNL2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CCNL2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CCNL2 gene in the plasmid vector map.
PVT22912 pCMV-SPORT6-EIF4B Gentaur supplies 2ug of lyophilized CMV-SPORT6-EIF4B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EIF4B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EIF4B gene in the plasmid vector map.
PVT22913 pCMV-SPORT6-C11orf71-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-C11orf71-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-C11orf71-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a C11orf71 gene in the plasmid vector map.
PVT22914 pCMV-SPORT6-CHM Gentaur supplies 2ug of lyophilized CMV-SPORT6-CHM Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CHM plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CHM gene in the plasmid vector map.
PVT22915 pCMV-SPORT6-IGL@ Gentaur supplies 2ug of lyophilized CMV-SPORT6-IGL@ Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-IGL@ plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a IGL@ gene in the plasmid vector map.
PVT22916 pCMV-SPORT6-MIOX-2 Gentaur supplies 2ug of lyophilized CMV-SPORT6-MIOX-2 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-MIOX-2 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a MIOX gene in the plasmid vector map.
PVT22917 pCMV-SPORT6-H2AC17 Gentaur supplies 2ug of lyophilized CMV-SPORT6-H2AC17 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-H2AC17 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a H2AC17 gene in the plasmid vector map.
PVT22918 pCMV-SPORT6-RAB1B Gentaur supplies 2ug of lyophilized CMV-SPORT6-RAB1B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-RAB1B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a RAB1B gene in the plasmid vector map.
PVT22919 pCMV-SPORT6-TMEM68 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TMEM68 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TMEM68 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TMEM68 gene in the plasmid vector map.
PVT22920 pCMV-SPORT6-ST13 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ST13 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ST13 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ST13 gene in the plasmid vector map.
PVT22921 pCMV-SPORT6-ZFC3H1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-ZFC3H1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ZFC3H1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ZFC3H1 gene in the plasmid vector map.
PVT22922 pCMV-SPORT6-CXCR1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-CXCR1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-CXCR1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a CXCR1 gene in the plasmid vector map.
PVT22923 pCMV-SPORT6-DBC1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-DBC1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-DBC1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a DBC1 gene in the plasmid vector map.
PVT22924 pCMV-SPORT6-FAM71E1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-FAM71E1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-FAM71E1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a FAM71E1 gene in the plasmid vector map.
PVT22925 pCMV-SPORT6-INSL3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-INSL3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-INSL3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a INSL3 gene in the plasmid vector map.
PVT22926 pCMV-SPORT6-EEF1A1-3 Gentaur supplies 2ug of lyophilized CMV-SPORT6-EEF1A1-3 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-EEF1A1-3 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a EEF1A1 gene in the plasmid vector map.
PVT22927 pCMV-SPORT6-TAF9B Gentaur supplies 2ug of lyophilized CMV-SPORT6-TAF9B Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TAF9B plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TAF9B gene in the plasmid vector map.
PVT22928 pCMV-SPORT6-ILRUN Gentaur supplies 2ug of lyophilized CMV-SPORT6-ILRUN Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-ILRUN plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a ILRUN gene in the plasmid vector map.
PVT22929 pCMV-SPORT6-HMGN1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-HMGN1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-HMGN1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a HMGN1 gene in the plasmid vector map.
PVT22930 pCMV-SPORT6-WBP1 Gentaur supplies 2ug of lyophilized CMV-SPORT6-WBP1 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-WBP1 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a WBP1 gene in the plasmid vector map.
PVT22931 pCMV-SPORT6-TCEAL6 Gentaur supplies 2ug of lyophilized CMV-SPORT6-TCEAL6 Plasmid in powder form at 4°C to be centrifuged at 5000rpm/min for 1min. Add 20μl ddH2O in to the vial of the pCMV-SPORT6-TCEAL6 plasmid. The pCMV promotor is combined with a SPORT6 vector sequence and a TCEAL6 gene in the plasmid vector map.

Genomics Overzicht

  Genetische Manipulaties AAV (Adeno Associated Virus) productlijn Geacetyleerde histondetectie Geacetyleerd histon-doelonderzoek Adenovirus-productlijn Biochemicaliën Capillaire elektroforese DNA-sequencing (Sanger-sequencing) cDNA-klonen cDNA-normalisatie cDNA-standaarden cDNA-synthese Hulpmiddelen voor celbeplating Cell Tracking door genetische NGS-streepjescode-etikettering Chromatine-analyse Circulerende histon kwantificering Kloon Screening Kits Klonen en expressievectoren Kits voor het klonen Kloondiensten Competente E. coli-cellen Competente Vibrio natriegens-cellen DNA-versterking DNA- en histon-demethylase-assays […]

ACROBiosystems

ACRO Biosystems Recombinante eiwitten voor de biofarmaceutische industrie Gentaur ACROBiosystems is een toonaangevende fabrikant van recombinante eiwitten en andere kritische reagentia ter ondersteuning van de ontwikkeling van doeltherapie. Het bedrijf hanteert een toepassingsgerichte ontwikkelingsstrategie, met een bijzondere focus op productontwerp, kwaliteitscontrole en oplossingsgerichte ondersteuning. De producten en diensten van ACROBiosystems stellen iedereen op het gebied […]

BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

PRKN

Parkin (PRKN) Antibody

20-abx133269
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

20-abx013170
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032820-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032820-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032821-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx032821-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx236149-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Parkin (PRKN) Antibody

20-abx329459
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

abx332454-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Parkin (PRKN) Antibody

20-abx324391
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-PRKN Antibody

STJ502119 100 µg
EUR 476

Anti-Parkin/PRKN Antibody

PB9307 100ug/vial
EUR 334

Anti-PRKN Antibody (Biotin)

STJ502120 100 µg
EUR 586

Anti-PRKN Antibody (FITC)

STJ502121 100 µg
EUR 586

PRKN ELISA Kit (Rat) (OKEH08514)

OKEH08514 96 Wells
EUR 896
Description: Description of target: localized to the cytoplasm in neurons of many regions of the brain; has N-terminal ubiquitin and ring-IBR-ring finger domains [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10pg/mL

Parkin Phospho-Ser131 (PRKN pS131) Antibody

20-abx322972
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human E3 ubiquitin-protein ligase parkin (PRKN)

1-CSB-EP017451HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase parkin(PRKN) expressed in E.coli

Human E3 ubiquitin-protein ligase parkin (PRKN)

1-CSB-BP017451HU
  • EUR 593.00
  • EUR 255.00
  • EUR 1481.00
  • EUR 791.00
  • EUR 1086.00
  • EUR 347.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase parkin(PRKN) expressed in Baculovirus

PROZ

Human Protein Z (PROZ) ELISA Kit

DLR-PROZ-Hu-96T 96T
EUR 621
  • Should the Human Protein Z (PROZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Z (PROZ) in samples from plasma.

Mouse Protein Z (PROZ) ELISA Kit

DLR-PROZ-Mu-48T 48T
EUR 489
  • Should the Mouse Protein Z (PROZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Protein Z (PROZ) in samples from plasma.

Mouse Protein Z (PROZ) ELISA Kit

DLR-PROZ-Mu-96T 96T
EUR 635
  • Should the Mouse Protein Z (PROZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Protein Z (PROZ) in samples from plasma.

Human Protein Z (PROZ) ELISA Kit

RDR-PROZ-Hu-48Tests 48 Tests
EUR 500

Human Protein Z (PROZ) ELISA Kit

RDR-PROZ-Hu-96Tests 96 Tests
EUR 692

Mouse Protein Z (PROZ) ELISA Kit

RDR-PROZ-Mu-48Tests 48 Tests
EUR 511

Mouse Protein Z (PROZ) ELISA Kit

RDR-PROZ-Mu-96Tests 96 Tests
EUR 709

Human Protein Z (PROZ) ELISA Kit

RD-PROZ-Hu-48Tests 48 Tests
EUR 478

Human Protein Z (PROZ) ELISA Kit

RD-PROZ-Hu-96Tests 96 Tests
EUR 662

Mouse Protein Z (PROZ) ELISA Kit

RD-PROZ-Mu-48Tests 48 Tests
EUR 489

Mouse Protein Z (PROZ) ELISA Kit

RD-PROZ-Mu-96Tests 96 Tests
EUR 677

PROZ antibody

10R-1813 100 ul
EUR 403
Description: Mouse monoclonal PROZ antibody

PROZ siRNA

20-abx929902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROZ siRNA

20-abx929903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROZ Polyclonal Antibody

29714-100ul 100ul
EUR 252

PROZ Polyclonal Antibody

29714-50ul 50ul
EUR 187

PROZ Polyclonal Antibody

29715-100ul 100ul
EUR 252

PROZ Polyclonal Antibody

29715-50ul 50ul
EUR 187

PROZ Rabbit pAb

A16082-100ul 100 ul
EUR 308

PROZ Rabbit pAb

A16082-200ul 200 ul
EUR 459

PROZ Rabbit pAb

A16082-20ul 20 ul
EUR 183

PROZ Rabbit pAb

A16082-50ul 50 ul
EUR 223

PROZ Rabbit pAb

A16083-100ul 100 ul
EUR 308

PROZ Rabbit pAb

A16083-200ul 200 ul
EUR 459

PROZ Rabbit pAb

A16083-20ul 20 ul
EUR 183

PROZ Rabbit pAb

A16083-50ul 50 ul
EUR 223

anti-PROZ (2B4)

LF-MA30302 100 ul
EUR 486
Description: Mouse Monoclonal to PROZ

Anti-PROZ antibody

STJ118535 100 µl
EUR 277

Anti-PROZ antibody

STJ118536 100 µl
EUR 277

Protein Z (PROZ) Antibody

20-abx178183
  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protein Z (PROZ) Antibody

20-abx178184
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Protein Z (PROZ) Antibody

20-abx129390
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Z (PROZ) Antibody

20-abx174291
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human PROZ ELISA Kit

ELA-E0736h 96 Tests
EUR 824

Human ProZ ELISA Kit

EHP0152 96Tests
EUR 521

Bovine ProZ ELISA Kit

EBP0152 96Tests
EUR 521

Anserini ProZ ELISA Kit

EAP0152 96Tests
EUR 521

Chicken ProZ ELISA Kit

ECKP0152 96Tests
EUR 521

Canine ProZ ELISA Kit

ECP0152 96Tests
EUR 521

Goat ProZ ELISA Kit

EGTP0152 96Tests
EUR 521

PROZ ELISA KIT|Human

EF000977 96 Tests
EUR 689

Mouse PROZ shRNA Plasmid

20-abx975849
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PROZ Polyclonal Conjugated Antibody

C29714 100ul
EUR 397

PROZ Polyclonal Conjugated Antibody

C29715 100ul
EUR 397

Human PROZ shRNA Plasmid

20-abx955850
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine ProZ ELISA Kit

EPP0152 96Tests
EUR 521

Sheep ProZ ELISA Kit

ESP0152 96Tests
EUR 521

Rat ProZ ELISA Kit

ERP0152 96Tests
EUR 521

Rabbit ProZ ELISA Kit

ERTP0152 96Tests
EUR 521

Monkey ProZ ELISA Kit

EMKP0152 96Tests
EUR 521

Mouse ProZ ELISA Kit

EMP0152 96Tests
EUR 521

Recombinant Protein Z (PROZ)

4-RPA736Mu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CQW3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 71.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Protein Z expressed in: E.coli

PROZ Recombinant Protein (Human)

RP085035 100 ug Ask for price

PROZ Recombinant Protein (Mouse)

RP164777 100 ug Ask for price

Mouse Protein Z (PROZ) Protein

20-abx167987
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

OTOA

OTOA siRNA

20-abx927444
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OTOA cloning plasmid

CSB-CL017271HU-10ug 10ug
EUR 1214
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3420
  • Sequence: ATGTCTCAGGAACCTACGACATACTCCCTTTTCCTATTCCTTTTTCTGAGCCATGGAGTGTCGAGTTATACAGTGCCAAATTCCAGGCAGGATTTGCATCCATTGTTGCAAAACATGGCGGAAGAAATAATAGATGGAAGCTATCTGAATGCACTGCTGGATCTCATACAGTTTC
  • Show more
Description: A cloning plasmid for the OTOA gene.

Otoancorin (OTOA) Antibody

abx026120-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Otoancorin (OTOA) Antibody

abx026120-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mouse OTOA shRNA Plasmid

20-abx982809
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OTOA shRNA Plasmid

20-abx965458
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal OTOA Antibody (N-term)

APR14234G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OTOA (N-term). This antibody is tested and proven to work in the following applications:

Mouse Otoancorin, Otoa ELISA KIT

ELI-37019m 96 Tests
EUR 865

Human Otoancorin, OTOA ELISA KIT

ELI-37638h 96 Tests
EUR 824

OTOA ORF Vector (Human) (pORF)

ORF013986 1.0 ug DNA
EUR 354

Otoa ORF Vector (Mouse) (pORF)

ORF053199 1.0 ug DNA
EUR 506

Human Otoancorin(OTOA)ELISA Kit

QY-E04722 96T
EUR 394

OTOA sgRNA CRISPR Lentivector set (Human)

K1576301 3 x 1.0 ug
EUR 339

Otoa sgRNA CRISPR Lentivector set (Mouse)

K3588401 3 x 1.0 ug
EUR 339

OTOA sgRNA CRISPR Lentivector (Human) (Target 1)

K1576302 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 2)

K1576303 1.0 ug DNA
EUR 154

OTOA sgRNA CRISPR Lentivector (Human) (Target 3)

K1576304 1.0 ug DNA
EUR 154

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3588402 1.0 ug DNA
EUR 154

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3588403 1.0 ug DNA
EUR 154

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3588404 1.0 ug DNA
EUR 154

OTOA Protein Vector (Human) (pPB-C-His)

PV055941 500 ng
EUR 481

OTOA Protein Vector (Human) (pPB-N-His)

PV055942 500 ng
EUR 481

OTOA Protein Vector (Human) (pPM-C-HA)

PV055943 500 ng
EUR 481

OTOA Protein Vector (Human) (pPM-C-His)

PV055944 500 ng
EUR 481

OTOA Protein Vector (Mouse) (pPB-C-His)

PV212794 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPB-N-His)

PV212795 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPM-C-HA)

PV212796 500 ng
EUR 1065

OTOA Protein Vector (Mouse) (pPM-C-His)

PV212797 500 ng
EUR 1065

Otoa 3'UTR GFP Stable Cell Line

TU165764 1.0 ml Ask for price

OTOA 3'UTR Luciferase Stable Cell Line

TU017194 1.0 ml
EUR 1394

Otoa 3'UTR Luciferase Stable Cell Line

TU115764 1.0 ml Ask for price

OTOA 3'UTR GFP Stable Cell Line

TU067194 1.0 ml
EUR 1394

Otoa 3'UTR GFP Stable Cell Line

TU265684 1.0 ml Ask for price

Otoa 3'UTR Luciferase Stable Cell Line

TU215684 1.0 ml Ask for price

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1576305 3 x 1.0 ug
EUR 376

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3588405 3 x 1.0 ug
EUR 376

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1576306 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1576307 1.0 ug DNA
EUR 167

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1576308 1.0 ug DNA
EUR 167

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3588406 1.0 ug DNA
EUR 167

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3588407 1.0 ug DNA
EUR 167

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3588408 1.0 ug DNA
EUR 167

PIGB

PIGB Antibody

1-CSB-PA017967GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PIGB. Recognizes PIGB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PIGB siRNA

20-abx928559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIGB siRNA

20-abx928560
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti- PIGB antibody

FNab06439 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class B
  • Uniprot ID: Q92521
  • Gene ID: 9488
  • Research Area: Metabolism
Description: Antibody raised against PIGB

Anti-PIGB antibody

PAab06439 100 ug
EUR 386

Anti-PIGB (2G7)

YF-MA16881 100 ug
EUR 363
Description: Mouse monoclonal to PIGB

PIGB ELISA KIT|Human

EF001775 96 Tests
EUR 689

Mouse PIGB shRNA Plasmid

20-abx974574
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIGB shRNA Plasmid

20-abx956300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGB Recombinant Protein (Human)

RP083250 100 ug Ask for price

PIGB Recombinant Protein (Mouse)

RP162017 100 ug Ask for price

PIGB Recombinant Protein (Rat)

RP220466 100 ug Ask for price

Pigb ORF Vector (Rat) (pORF)

ORF073490 1.0 ug DNA
EUR 506

PIGB ORF Vector (Human) (pORF)

ORF027751 1.0 ug DNA
EUR 405

Pigb ORF Vector (Mouse) (pORF)

ORF054007 1.0 ug DNA
EUR 506

Pigb sgRNA CRISPR Lentivector set (Mouse)

K4762901 3 x 1.0 ug
EUR 339

Pigb sgRNA CRISPR Lentivector set (Rat)

K6227301 3 x 1.0 ug
EUR 339

PIGB sgRNA CRISPR Lentivector set (Human)

K1646801 3 x 1.0 ug
EUR 339

Mouse GPI mannosyltransferase 3, Pigb ELISA KIT

ELI-12682m 96 Tests
EUR 865

Bovine GPI mannosyltransferase 3, PIGB ELISA KIT

ELI-20959b 96 Tests
EUR 928

Human GPI mannosyltransferase 3, PIGB ELISA KIT

ELI-45935h 96 Tests
EUR 824

Pigb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4762902 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4762903 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4762904 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6227302 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6227303 1.0 ug DNA
EUR 154

Pigb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6227304 1.0 ug DNA
EUR 154

PIGB sgRNA CRISPR Lentivector (Human) (Target 1)

K1646802 1.0 ug DNA
EUR 154

PIGB sgRNA CRISPR Lentivector (Human) (Target 2)

K1646803 1.0 ug DNA
EUR 154

PIGB sgRNA CRISPR Lentivector (Human) (Target 3)

K1646804 1.0 ug DNA
EUR 154

PIGB Protein Vector (Human) (pPB-C-His)

PV111002 500 ng
EUR 552

PIGB Protein Vector (Human) (pPB-N-His)

PV111003 500 ng
EUR 552

PIGB Protein Vector (Human) (pPM-C-HA)

PV111004 500 ng
EUR 552

PIGB Protein Vector (Human) (pPM-C-His)

PV111005 500 ng
EUR 552

PIGB Protein Vector (Rat) (pPB-C-His)

PV293958 500 ng
EUR 603

PIGB Protein Vector (Rat) (pPB-N-His)

PV293959 500 ng
EUR 603

PIGB Protein Vector (Rat) (pPM-C-HA)

PV293960 500 ng
EUR 603

PIGB Protein Vector (Rat) (pPM-C-His)

PV293961 500 ng
EUR 603

PIGB Protein Vector (Mouse) (pPB-C-His)

PV216026 500 ng
EUR 603

PIGB Protein Vector (Mouse) (pPB-N-His)

PV216027 500 ng
EUR 603

PIGB Protein Vector (Mouse) (pPM-C-HA)

PV216028 500 ng
EUR 603

PIGB Protein Vector (Mouse) (pPM-C-His)

PV216029 500 ng
EUR 603

Pigb 3'UTR Luciferase Stable Cell Line

TU116346 1.0 ml Ask for price

Pigb 3'UTR GFP Stable Cell Line

TU166346 1.0 ml Ask for price

Pigb 3'UTR Luciferase Stable Cell Line

TU216225 1.0 ml Ask for price

Pigb 3'UTR GFP Stable Cell Line

TU266225 1.0 ml Ask for price

PIGB 3'UTR GFP Stable Cell Line

TU067928 1.0 ml
EUR 1394

PIGB 3'UTR Luciferase Stable Cell Line

TU017928 1.0 ml
EUR 1394

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

20-abx114441
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx031401-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx031401-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) Antibody

abx236439-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human Phosphatidylinositol Glycan Anchor Biosynthesis Class B (PIGB) ELISA Kit

abx382225-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pigb sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4762905 3 x 1.0 ug
EUR 376

Pigb sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6227305 3 x 1.0 ug
EUR 376

PMM3

Product not found