Anti-SARS-CoV-2 nucleocapside-antilichamen

Konijn Monoclonale antilichemen

Anti-SARS-CoV-2 nucleocapside-antilichaam (DM38), konijn-mAb
Kat. Nee: DME100037 Kloonnummer: DM38 Toepassing: ELISA Grootte: 100 μl
USD 318,00Meer

Anti-SARS-CoV-2 nucleocapside-antilichaam (DM37), konijn-mAb
Kat. Nee: DME100036 Kloonnummer: DM37 Toepassing: ELISA Grootte: 100 μl
USD 318,00Meer

Anti-SARS-CoV-2 nucleocapside-antilichaam (DM36), konijn-mAb
Kat. Nee: DME100035 Kloonnummer: DM36 Toepassing: ELISA Grootte: 100 μl
USD 318,00Meer

Anti-SARS-CoV-2 RBD-antilichaam (DM35), konijn-mAb
Kat. Nee: DME100034 Kloonnummer: DM35 Toepassing: ELISA, Flow Cyt Grootte: 100 μl
USD 318,00Meer

Anti-SARS-CoV-2 RBD-antilichaam (DM27), konijn-mAb
Kat. Nee: DME100026 Kloonnummer: DM27 Toepassing: ELISA, Flow Cyt Grootte: 100 μl
USD 318,00Meer

Anti-SARS-CoV-2 RBD-antilichaam (DM26), konijn-mAb
Kat. Nee: DME100025 Kloonnummer: DM26 Toepassing: ELISA, Flow Cyt Grootte: 100 μl
USD 318,00


Anti-SARS-CoV-2 Nucleocapsid antibody(DM38), Rabbit mAb Technische fiche

Product Overview

Clone ID DM38
Immunogen Recombinant SARS-CoV-2 Nucleocapsid (Met1-Ala419) (PME100459)produced by using E. coli
Buffer Preservative: 0.1% Procline 300
Constituents: 50% Glycerol; PBS,pH 7.4; 0.1% BSA
Catalog Number DME100037
Package 10 μl $60.00 ; 100 μl $318.00

Synonyms SARS-CoV-2 Nucleocapsid
Host Species Rabbit
IgG type Rabbit IgG
Clonality Monoclonal
Formulation Liquid
Purification Purified from cell culture supernatant by affinity chromatography
Reactivity SARS-CoV-2
Applications ELISA
Recommended Dilutions ELISA 1/5000-10000
Storage Store at -20°C for 12 months (Avoid repeated freezing and thawing)
Usage Research use only

anti spike
Nucleocapsid protein, His Tag

Figure 1. Elisa plate pre-coated by 2 μg/ml(100μl/well) SARS-CoV-2 Nucleocapsid protein, His Tag(Cat.No.PME100459) can bind Rabbit Anti-SARS-CoV-2 Nucleocapsid monoclonal antibody(clone:DM38) in a linear range of 0.12-15.63 ng/ml.


Coronavirus contain most of nucleocapsid protein. Coronavirus nucleoproteins (N proteins) localize to the cytoplasm and the nucleolus, a subnuclear structure, in both virus-infected primary cells and in cells transfected with plasmids that express N protein. The nucleolus is the site of ribosome biogenesis and sequesters cell cycle regulatory complexes. Two of the major components of the nucleolus are fibrillarin and nucleolin. These proteins are involved in nucleolar assembly and ribosome biogenesis and act as chaperones for the import of proteins into the nucleolus. Regarding of the conservation of N protein sequence and its strong immunogenicity, the N protein of coronavirus is a tool for diagnostic.


Genomics Overzicht

  Genetische Manipulaties AAV (Adeno Associated Virus) productlijn Geacetyleerde histondetectie Geacetyleerd histon-doelonderzoek Adenovirus-productlijn Biochemicaliën Capillaire elektroforese DNA-sequencing (Sanger-sequencing) cDNA-klonen cDNA-normalisatie cDNA-standaarden cDNA-synthese Hulpmiddelen voor celbeplating Cell Tracking door genetische NGS-streepjescode-etikettering Chromatine-analyse Circulerende histon kwantificering Kloon Screening Kits Klonen en expressievectoren Kits voor het klonen Kloondiensten Competente E. coli-cellen Competente Vibrio natriegens-cellen DNA-versterking DNA- en histon-demethylase-assays […]


VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti- FKBP9 antibody

FNab03150 100µg
EUR 505.25
  • Immunogen: FK506 binding protein 9, 63 kDa
  • Uniprot ID: O95302
  • Gene ID: 11328
  • Research Area: Metabolism
Description: Antibody raised against FKBP9

Anti-FKBP9 antibody

PAab03150 100 ug
EUR 355


EF009647 96 Tests
EUR 689

Rat FKBP9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FKBP9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FKBP9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Fkbp9 ELISA KIT

ELI-32493m 96 Tests
EUR 865


ELI-48448b 96 Tests
EUR 928


ELI-47448h 96 Tests
EUR 824

FKBP9 Recombinant Protein (Human)

RP058899 100 ug Ask for price

FKBP9 Recombinant Protein (Rat)

RP201497 100 ug Ask for price

FKBP9 Recombinant Protein (Mouse)

RP134753 100 ug Ask for price

Polyclonal FKBP9 Antibody (N-term)

APR15994G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP9 (N-term). This antibody is tested and proven to work in the following applications:

Fkbp9 ORF Vector (Rat) (pORF)

ORF067167 1.0 ug DNA
EUR 506

FKBP9 ORF Vector (Human) (pORF)

ORF019634 1.0 ug DNA
EUR 405

Fkbp9 ORF Vector (Mouse) (pORF)

ORF044919 1.0 ug DNA
EUR 506

FK506 Binding Protein 9 (FKBP9) Antibody

abx033368-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

FK506 Binding Protein 9 (FKBP9) Antibody

abx033368-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FK506 Binding Protein 9 (FKBP9) Antibody

abx033369-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

FK506 Binding Protein 9 (FKBP9) Antibody

abx033369-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FK506 Binding Protein 9 (FKBP9) Antibody

abx233150-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fkbp9 sgRNA CRISPR Lentivector set (Rat)

K7485801 3 x 1.0 ug
EUR 339

FKBP9 sgRNA CRISPR Lentivector set (Human)

K0785801 3 x 1.0 ug
EUR 339

Fkbp9 sgRNA CRISPR Lentivector set (Mouse)

K3163501 3 x 1.0 ug
EUR 339

Fkbp9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7485802 1.0 ug DNA
EUR 154

Fkbp9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7485803 1.0 ug DNA
EUR 154

Fkbp9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7485804 1.0 ug DNA
EUR 154

FKBP9 sgRNA CRISPR Lentivector (Human) (Target 1)

K0785802 1.0 ug DNA
EUR 154

FKBP9 sgRNA CRISPR Lentivector (Human) (Target 2)

K0785803 1.0 ug DNA
EUR 154

FKBP9 sgRNA CRISPR Lentivector (Human) (Target 3)

K0785804 1.0 ug DNA
EUR 154

Fkbp9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3163502 1.0 ug DNA
EUR 154

Fkbp9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3163503 1.0 ug DNA
EUR 154

Fkbp9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3163504 1.0 ug DNA
EUR 154

FKBP9 Protein Vector (Mouse) (pPB-C-His)

PV179674 500 ng
EUR 603

FKBP9 Protein Vector (Mouse) (pPB-N-His)

PV179675 500 ng
EUR 603

FKBP9 Protein Vector (Mouse) (pPM-C-HA)

PV179676 500 ng
EUR 603

FKBP9 Protein Vector (Mouse) (pPM-C-His)

PV179677 500 ng
EUR 603

FKBP9 Protein Vector (Rat) (pPB-C-His)

PV268666 500 ng
EUR 603

FKBP9 Protein Vector (Rat) (pPB-N-His)

PV268667 500 ng
EUR 603

FKBP9 Protein Vector (Rat) (pPM-C-HA)

PV268668 500 ng
EUR 603

FKBP9 Protein Vector (Rat) (pPM-C-His)

PV268669 500 ng
EUR 603

FKBP9 Protein Vector (Human) (pPB-C-His)

PV078533 500 ng
EUR 552

FKBP9 Protein Vector (Human) (pPB-N-His)

PV078534 500 ng
EUR 552

FKBP9 Protein Vector (Human) (pPM-C-HA)

PV078535 500 ng
EUR 552

FKBP9 Protein Vector (Human) (pPM-C-His)

PV078536 500 ng
EUR 552

Fkbp9 3'UTR GFP Stable Cell Line

TU156605 1.0 ml Ask for price

Fkbp9 3'UTR Luciferase Stable Cell Line

TU106605 1.0 ml Ask for price

Fkbp9 3'UTR Luciferase Stable Cell Line

TU204668 1.0 ml Ask for price

Fkbp9 3'UTR GFP Stable Cell Line

TU254668 1.0 ml Ask for price

FKBP9 3'UTR GFP Stable Cell Line

TU058005 1.0 ml
EUR 1521

FKBP9 3'UTR Luciferase Stable Cell Line

TU008005 1.0 ml
EUR 1521

Human FK506 Binding Protein 9 (FKBP9) ELISA Kit

abx387378-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FKBP9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679123 1.0 ug DNA
EUR 682

FKBP9 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679127 1.0 ug DNA
EUR 682

FKBP9 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679128 1.0 ug DNA
EUR 682

Fkbp9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7485805 3 x 1.0 ug
EUR 376

FKBP9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0785805 3 x 1.0 ug
EUR 376

Fkbp9 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3163505 3 x 1.0 ug
EUR 376

FKBP9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV679124 1.0 ug DNA
EUR 682

FKBP9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV679125 1.0 ug DNA
EUR 740

FKBP9 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV679126 1.0 ug DNA
EUR 740

Fkbp9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7485806 1.0 ug DNA
EUR 167

Fkbp9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7485807 1.0 ug DNA
EUR 167

Fkbp9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7485808 1.0 ug DNA
EUR 167

FKBP9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0785806 1.0 ug DNA
EUR 167

FKBP9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0785807 1.0 ug DNA
EUR 167

FKBP9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0785808 1.0 ug DNA
EUR 167


EIF3C antibody

70R-17046 50 ul
EUR 435
Description: Rabbit polyclonal EIF3C antibody

EIF3C Antibody

47321-100ul 100ul
EUR 252

EIF3C Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

EIF3C Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3C Conjugated Antibody

C47321 100ul
EUR 397

EIF3C cloning plasmid

CSB-CL857867HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2742
  • Sequence: atgtcgcggtttttcaccaccggttcggacagcgagtccgagtcgtccttgtccggggaggagctcgtcaccaaacctgtcggaggcaactatggcaaacagccattgttgctgagcgaggatgaagaagataccaagagagttgtccgcagtgccaaggacaagaggtttgagg
  • Show more
Description: A cloning plasmid for the EIF3C gene.

EIF3C Polyclonal Antibody

A67130 100 µg
EUR 570.55
Description: reagents widely cited

EIF3C Rabbit pAb

A7022-100ul 100 ul
EUR 308

EIF3C Rabbit pAb

A7022-200ul 200 ul
EUR 459

EIF3C Rabbit pAb

A7022-20ul 20 ul
EUR 183

EIF3C Rabbit pAb

A7022-50ul 50 ul
EUR 223

anti- EIF3C antibody

FNab02703 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: eukaryotic translation initiation factor 3, subunit C
  • Uniprot ID: Q99613
  • Gene ID: 8663
  • Research Area: Metabolism
Description: Antibody raised against EIF3C

Anti-EIF3C antibody

PAab02703 100 ug
EUR 386


PVT14144 2 ug
EUR 495

Anti-EIF3C antibody

STJ29102 100 µl
EUR 277

EIF3C Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF3C Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF3C Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3C. Recognizes EIF3C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Eif3c ELISA KIT

ELI-09164m 96 Tests
EUR 865


ELI-09999h 96 Tests
EUR 824


ELI-26098b 96 Tests
EUR 928


EF009339 96 Tests
EUR 689

Rat EIF3C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF3C shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF3C Polyclonal Antibody, HRP Conjugated

A67131 100 µg
EUR 570.55
Description: Ask the seller for details

EIF3C Polyclonal Antibody, FITC Conjugated

A67132 100 µg
EUR 570.55
Description: The best epigenetics products

EIF3C Polyclonal Antibody, Biotin Conjugated

A67133 100 µg
EUR 570.55
Description: kits suitable for this type of research

Eif3c ORF Vector (Rat) (pORF)

ORF066450 1.0 ug DNA
EUR 506

EIF3C ORF Vector (Human) (pORF)

ORF003466 1.0 ug DNA
EUR 95

Eif3c ORF Vector (Mouse) (pORF)

ORF043759 1.0 ug DNA
EUR 506

EIF3C sgRNA CRISPR Lentivector set (Human)

K0667201 3 x 1.0 ug
EUR 339

Eif3c sgRNA CRISPR Lentivector set (Rat)

K6287401 3 x 1.0 ug
EUR 339

Eif3c sgRNA CRISPR Lentivector set (Mouse)

K3973701 3 x 1.0 ug
EUR 339

EIF3C sgRNA CRISPR Lentivector (Human) (Target 1)

K0667202 1.0 ug DNA
EUR 154

EIF3C sgRNA CRISPR Lentivector (Human) (Target 2)

K0667203 1.0 ug DNA
EUR 154

EIF3C sgRNA CRISPR Lentivector (Human) (Target 3)

K0667204 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Rat) (Target 1)

K6287402 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Rat) (Target 2)

K6287403 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Rat) (Target 3)

K6287404 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3973702 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3973703 1.0 ug DNA
EUR 154

Eif3c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3973704 1.0 ug DNA
EUR 154

EIF3C Protein Vector (Mouse) (pPB-C-His)

PV175034 500 ng
EUR 1065

EIF3C Protein Vector (Mouse) (pPB-N-His)

PV175035 500 ng
EUR 1065

EIF3C Protein Vector (Mouse) (pPM-C-HA)

PV175036 500 ng
EUR 1065

EIF3C Protein Vector (Mouse) (pPM-C-His)

PV175037 500 ng
EUR 1065

EIF3C Protein Vector (Rat) (pPB-C-His)

PV265798 500 ng
EUR 1166

EIF3C Protein Vector (Rat) (pPB-N-His)

PV265799 500 ng
EUR 1166

EIF3C Protein Vector (Rat) (pPM-C-HA)

PV265800 500 ng
EUR 1166

EIF3C Protein Vector (Rat) (pPM-C-His)

PV265801 500 ng
EUR 1166

EIF3C Protein Vector (Human) (pPB-C-His)

PV013861 500 ng
EUR 329

EIF3C Protein Vector (Human) (pPB-N-His)

PV013862 500 ng
EUR 329

EIF3C Protein Vector (Human) (pPM-C-HA)

PV013863 500 ng
EUR 329

EIF3C Protein Vector (Human) (pPM-C-His)

PV013864 500 ng
EUR 329

Eif3c 3'UTR GFP Stable Cell Line

TU155715 1.0 ml Ask for price

Eif3c 3'UTR Luciferase Stable Cell Line

TU105715 1.0 ml Ask for price

Eif3c 3'UTR Luciferase Stable Cell Line

TU203882 1.0 ml Ask for price

Eif3c 3'UTR GFP Stable Cell Line

TU253882 1.0 ml Ask for price

EIF3C 3'UTR GFP Stable Cell Line

TU056730 1.0 ml
EUR 2333

EIF3C 3'UTR Luciferase Stable Cell Line

TU006730 1.0 ml
EUR 2333

EIF3C Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV687175 1.0 ug DNA
EUR 1355

EIF3C Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV687179 1.0 ug DNA
EUR 1355

EIF3C Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV687180 1.0 ug DNA
EUR 1355

Eukaryotic Translation Initiation Factor 3 Subunit C (EIF3C) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit C (EIF3C) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 3 Subunit C (eIF3C) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.


ERO1A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ERO1A. Recognizes ERO1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ERO1A Rabbit pAb

A11806-100ul 100 ul
EUR 308

ERO1A Rabbit pAb

A11806-200ul 200 ul
EUR 459

ERO1A Rabbit pAb

A11806-20ul 20 ul Ask for price

ERO1A Rabbit pAb

A11806-50ul 50 ul Ask for price


PVT13064 2 ug
EUR 391

Anti-ERO1A antibody

STJ113385 100 µl
EUR 277

ERO1-Like Protein Alpha (ERO1A) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

ERO1-Like Protein Alpha (ERO1A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ERO1-Like Protein Alpha (ERO1A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

pPLK/GFP+Puro-Ero1a shRNA-1 Plasmid

PVTB50074-3a 2 ug
EUR 356

pPLK/GFP+Puro-Ero1a shRNA-2 Plasmid

PVTB50074-3b 2 ug
EUR 356

pPLK/GFP+Puro-Ero1a shRNA-3 Plasmid

PVTB50074-3c 2 ug
EUR 356

Human ERO1-Like Protein Alpha (ERO1A) ELISA Kit

abx387190-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC5 antibody

70R-3820 50 ug
EUR 467
Description: Rabbit polyclonal EXOC5 antibody raised against the N terminal of EXOC5

EXOC5 antibody

70R-17169 50 ul
EUR 435
Description: Rabbit polyclonal EXOC5 antibody

EXOC5 Antibody

DF12397 200ul
EUR 304
Description: EXOC5 antibody detects endogenous levels of EXOC5.

EXOC5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EXOC5. Recognizes EXOC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF


YF-PA17125 50 ul
EUR 363
Description: Mouse polyclonal to EXOC5


YF-PA17126 50 ug
EUR 363
Description: Mouse polyclonal to EXOC5

EXOC5 cloning plasmid

CSB-CL007883HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2127
  • Sequence: atggctaccacggccgagctcttcgaggagccttttgtggcagatgaatatattgaacgtcttgtatggagaaccccaggaggaggctctagaggtggacctgaagcttttgatcctaaaagattattagaagaatttgtaaatcatattcaggaactccagataatggatgaaa
  • Show more
Description: A cloning plasmid for the EXOC5 gene.

anti- EXOC5 antibody

FNab02894 100µg
EUR 505.25
  • Immunogen: exocyst complex component 5
  • Uniprot ID: O00471
  • Gene ID: 10640
  • Research Area: Signal Transduction
Description: Antibody raised against EXOC5

EXOC5 Rabbit pAb

A9282-100ul 100 ul
EUR 308

EXOC5 Rabbit pAb

A9282-200ul 200 ul
EUR 459

EXOC5 Rabbit pAb

A9282-20ul 20 ul
EUR 183

EXOC5 Rabbit pAb

A9282-50ul 50 ul
EUR 223

EXOC5 Blocking Peptide

33R-1562 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC5 antibody, catalog no. 70R-3820

EXOC5 Polyclonal Antibody

31695-100ul 100ul
EUR 252

EXOC5 Polyclonal Antibody

31695-50ul 50ul
EUR 187

EXOC5 Blocking Peptide

DF12397-BP 1mg
EUR 195

Anti-EXOC5 antibody

PAab02894 100 ug
EUR 355

Anti-EXOC5 antibody

STJ111636 100 µl
EUR 277
Description: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity.

EXOC5 Polyclonal Conjugated Antibody

C31695 100ul
EUR 397

Mouse EXOC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EXOC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009473 96 Tests
EUR 689

Human EXOC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC5 Recombinant Protein (Human)

RP011044 100 ug Ask for price


PVT16778 2 ug
EUR 325

EXOC5 Recombinant Protein (Rat)

RP200093 100 ug Ask for price

EXOC5 Recombinant Protein (Mouse)

RP132479 100 ug Ask for price

Polyclonal EXOC5 Antibody (C-term)

APR15892G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXOC5 (C-term). This antibody is tested and proven to work in the following applications:

EXOC5 ORF Vector (Human) (pORF)

ORF003682 1.0 ug DNA
EUR 95

Exoc5 ORF Vector (Rat) (pORF)

ORF066699 1.0 ug DNA
EUR 506

Exoc5 ORF Vector (Mouse) (pORF)

ORF044161 1.0 ug DNA
EUR 506

Exocyst Complex Component 5 (EXOC5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 5 (EXOC5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 5 (EXOC5) Antibody

abx232894-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Exoc5 sgRNA CRISPR Lentivector set (Mouse)

K4556201 3 x 1.0 ug
EUR 339

EXOC5 sgRNA CRISPR Lentivector set (Human)

K0702701 3 x 1.0 ug
EUR 339

Exoc5 sgRNA CRISPR Lentivector set (Rat)

K6796501 3 x 1.0 ug
EUR 339

Exoc5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4556202 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4556203 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4556204 1.0 ug DNA
EUR 154

EXOC5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0702702 1.0 ug DNA
EUR 154

EXOC5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0702703 1.0 ug DNA
EUR 154

EXOC5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0702704 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6796502 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6796503 1.0 ug DNA
EUR 154

Exoc5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6796504 1.0 ug DNA
EUR 154

EXOC5 Protein Vector (Mouse) (pPB-C-His)

PV176642 500 ng
EUR 1065

EXOC5 Protein Vector (Mouse) (pPB-N-His)

PV176643 500 ng
EUR 1065

EXOC5 Protein Vector (Mouse) (pPM-C-HA)

PV176644 500 ng
EUR 1065

EXOC5 Protein Vector (Mouse) (pPM-C-His)

PV176645 500 ng
EUR 1065

EXOC5 Protein Vector (Human) (pPB-C-His)

PV014725 500 ng
EUR 329

EXOC5 Protein Vector (Human) (pPB-N-His)

PV014726 500 ng
EUR 329

EXOC5 Protein Vector (Human) (pPM-C-HA)

PV014727 500 ng
EUR 329

EXOC5 Protein Vector (Human) (pPM-C-His)

PV014728 500 ng
EUR 329

EXOC5 Protein Vector (Rat) (pPB-C-His)

PV266794 500 ng
EUR 1166

EXOC5 Protein Vector (Rat) (pPB-N-His)

PV266795 500 ng
EUR 1166

EXOC5 Protein Vector (Rat) (pPM-C-HA)

PV266796 500 ng
EUR 1166

EXOC5 Protein Vector (Rat) (pPM-C-His)

PV266797 500 ng
EUR 1166

Exoc5 3'UTR Luciferase Stable Cell Line

TU204152 1.0 ml Ask for price

Exoc5 3'UTR GFP Stable Cell Line

TU156010 1.0 ml Ask for price

EXOC5 3'UTR Luciferase Stable Cell Line

TU007123 1.0 ml
EUR 4617

Exoc5 3'UTR Luciferase Stable Cell Line

TU106010 1.0 ml Ask for price

EXOC5 3'UTR GFP Stable Cell Line

TU057123 1.0 ml
EUR 4617

Exoc5 3'UTR GFP Stable Cell Line

TU254152 1.0 ml Ask for price

Human Exocyst complex component 5, EXOC5 ELISA KIT

ELI-20567h 96 Tests
EUR 824

Mouse Exocyst complex component 5, Exoc5 ELISA KIT

ELI-47670m 96 Tests
EUR 865

Human Exocyst Complex Component 5 (EXOC5) ELISA Kit

abx387215-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC7 antibody

22034-100ul 100ul
EUR 390

EXOC7 antibody

22233-100ul 100ul
EUR 390

EXOC7 antibody

70R-17171 50 ul
EUR 435
Description: Rabbit polyclonal EXOC7 antibody

EXOC7 antibody

70R-13469 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal EXOC7 antibody

EXOC7 antibody

70R-13474 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal EXOC7 antibody

EXOC7 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXOC7 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:50-1:200


PVT11498 2 ug
EUR 273


YF-PA25859 50 ul
EUR 334
Description: Mouse polyclonal to EXOC7

EXOC7 cloning plasmid

CSB-CL007886HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atgaggccctgggttgccgtgctctcgctgttcccctctcggggctgggctggggccgctcttggccccaaggttgccccgggccagcagcccagccagcagcacagtctctatggtgctgaggaagagcagcagcagcaggatggtgaagtagtaaactgggggaggcagggcac
  • Show more
Description: A cloning plasmid for the EXOC7 gene.

EXOC7 cloning plasmid

CSB-CL007886HU2-10ug 10ug
EUR 685
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2055
  • Sequence: atgattcccccacaggaggcatccgctcgacggcgggagattgaggacaagctgaagcaggaggaggagactctgtccttcatccgagacagcctggagaagagcgaccagctcactaagaacatggtgtctatcttatcatcctttgagagccgccttatgaagctggagaact
  • Show more
Description: A cloning plasmid for the EXOC7 gene.

Anti-EXOC7 antibody

STJ70915 100 µg
EUR 359

Anti-EXOC7 (1B7)

YF-MA17831 100 ug
EUR 363
Description: Mouse monoclonal to EXOC7

Anti-EXOC7 (1D4)

YF-MA11400 100 ug
EUR 363
Description: Mouse monoclonal to EXOC7

Polyclonal EXOC7 Antibody (Internal)

APR15894G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EXOC7 (Internal). This antibody is tested and proven to work in the following applications:

Mouse EXOC7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EXOC7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EXOC7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC7 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EXOC7 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EXOC7 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXOC7. Recognizes EXOC7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EXOC7 Recombinant Protein (Human)

RP011050 100 ug Ask for price

EXOC7 Recombinant Protein (Human)

RP011053 100 ug Ask for price

EXOC7 Recombinant Protein (Rat)

RP200102 100 ug Ask for price

EXOC7 Recombinant Protein (Mouse)

RP132488 100 ug Ask for price

EXOC7 Recombinant Protein (Mouse)

RP132491 100 ug Ask for price

Polyclonal Goat Anti-EXOC7 Antibody

APR16277G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EXOC7 . This antibody is tested and proven to work in the following applications:

EXOC7 ORF Vector (Human) (pORF)

ORF003684 1.0 ug DNA
EUR 95

EXOC7 ORF Vector (Human) (pORF)

ORF003685 1.0 ug DNA
EUR 95

Exoc7 ORF Vector (Rat) (pORF)

ORF066702 1.0 ug DNA
EUR 506

Exoc7 ORF Vector (Mouse) (pORF)

ORF044164 1.0 ug DNA
EUR 506

Exoc7 ORF Vector (Mouse) (pORF)

ORF044165 1.0 ug DNA
EUR 506

Exocyst Complex Component 7 (EXOC7) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 7 (EXOC7) Antibody

abx432668-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Exoc7 sgRNA CRISPR Lentivector set (Mouse)

K3473501 3 x 1.0 ug
EUR 339

EXOC7 sgRNA CRISPR Lentivector set (Human)

K0703001 3 x 1.0 ug
EUR 339

Exoc7 sgRNA CRISPR Lentivector set (Rat)

K6978501 3 x 1.0 ug
EUR 339

Monoclonal EXOC7 Antibody (monoclonal) (M01), Clone: 1D4

APR15895G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human EXOC7 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1D4. This antibody is applicable in WB and IHC, E

Exoc7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3473502 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3473503 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3473504 1.0 ug DNA
EUR 154

EXOC7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0703002 1.0 ug DNA
EUR 154

EXOC7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0703003 1.0 ug DNA
EUR 154

EXOC7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0703004 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6978502 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6978503 1.0 ug DNA
EUR 154

Exoc7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6978504 1.0 ug DNA
EUR 154

EXOC7 Protein Vector (Mouse) (pPB-C-His)

PV176654 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPB-N-His)

PV176655 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPM-C-HA)

PV176656 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPM-C-His)

PV176657 500 ng
EUR 603

EXOC7 Protein Vector (Mouse) (pPB-C-His)

PV176658 500 ng
EUR 1065

EXOC7 Protein Vector (Mouse) (pPB-N-His)

PV176659 500 ng
EUR 1065

EXOC7 Protein Vector (Mouse) (pPM-C-HA)

PV176660 500 ng
EUR 1065

EXOC7 Protein Vector (Mouse) (pPM-C-His)

PV176661 500 ng
EUR 1065

EXOC7 Protein Vector (Human) (pPB-C-His)

PV014733 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPB-N-His)

PV014734 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-HA)

PV014735 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-His)

PV014736 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPB-C-His)

PV014737 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPB-N-His)

PV014738 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-HA)

PV014739 500 ng
EUR 329

EXOC7 Protein Vector (Human) (pPM-C-His)

PV014740 500 ng
EUR 329

EXOC7 Protein Vector (Rat) (pPB-C-His)

PV266806 500 ng
EUR 603

EXOC7 Protein Vector (Rat) (pPB-N-His)

PV266807 500 ng
EUR 603

EXOC7 Protein Vector (Rat) (pPM-C-HA)

PV266808 500 ng
EUR 603

EXOC7 Protein Vector (Rat) (pPM-C-His)

PV266809 500 ng
EUR 603



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW4 Antibody

39899-100ul 100ul
EUR 390

FBXW4 antibody

70R-17269 50 ul
EUR 435
Description: Rabbit polyclonal FBXW4 antibody

FBXW4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW4. Recognizes FBXW4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FBXW4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW4. Recognizes FBXW4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FBXW4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBXW4. Recognizes FBXW4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

FBXW4 cloning plasmid

CSB-CL008525HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atgccctggatgcagctagaggatgattctctgtacatatcccaggctaatttcatcctggcctaccagttccgtccagatggtgccagcttgaatcgtcggcctctgggagtctttgctgggcatgatgaggacgtttgccactttgtgctggccaactcgcatattgttagtgc
  • Show more
Description: A cloning plasmid for the FBXW4 gene.

anti- FBXW4 antibody

FNab03055 100µg
EUR 505.25
  • Immunogen: F-box and WD repeat domain containing 4
  • Uniprot ID: P57775
  • Gene ID: 6468
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against FBXW4

FBXW4 Rabbit pAb

A8149-100ul 100 ul
EUR 308

FBXW4 Rabbit pAb

A8149-200ul 200 ul
EUR 459

FBXW4 Rabbit pAb

A8149-20ul 20 ul
EUR 183

FBXW4 Rabbit pAb

A8149-50ul 50 ul
EUR 223

FBXW4 Polyclonal Antibody

31453-100ul 100ul
EUR 252

FBXW4 Polyclonal Antibody

31453-50ul 50ul
EUR 187

Anti-FBXW4 antibody

PAab03055 100 ug
EUR 355

Anti-FBXW4 Antibody

STJ500990 100 µg
EUR 476

Anti-FBXW4 antibody

STJ110448 100 µl
EUR 277
Description: This gene is a member of the F-box/WD-40 gene family, which recruit specific target proteins through their WD-40 protein-protein binding domains for ubiquitin mediated degradation. In mouse, a highly similar protein is thought to be responsible for maintaining the apical ectodermal ridge of developing limb buds; disruption of the mouse gene results in the absence of central digits, underdeveloped or absent metacarpal/metatarsal bones and syndactyly. This phenotype is remarkably similar to split hand-split foot malformation in humans, a clinically heterogeneous condition with a variety of modes of transmission. An autosomal recessive form has been mapped to the chromosomal region where this gene is located, and complex rearrangements involving duplications of this gene and others have been associated with the condition. A pseudogene of this locus has been mapped to one of the introns of the BCR gene on chromosome 22.

FBXW4 Polyclonal Conjugated Antibody

C31453 100ul
EUR 397

Mouse FBXW4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009596 96 Tests
EUR 689

Human FBXW4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW4 Recombinant Protein (Human)

RP011962 100 ug Ask for price

FBXW4 Recombinant Protein (Rat)

RP201077 100 ug Ask for price

FBXW4 Recombinant Protein (Mouse)

RP134153 100 ug Ask for price

Anti-FBXW4 Antibody (Biotin)

STJ500991 100 µg
EUR 586

Anti-FBXW4 Antibody (FITC)

STJ500992 100 µg
EUR 586

FBXW4 ORF Vector (Human) (pORF)

ORF003988 1.0 ug DNA
EUR 95

Fbxw4 ORF Vector (Rat) (pORF)

ORF067027 1.0 ug DNA
EUR 506

Fbxw4 ORF Vector (Mouse) (pORF)

ORF044719 1.0 ug DNA
EUR 506

Polyclonal SHFM3 / FBXW4 Antibody (aa5-186)

APR03106G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SHFM3 / FBXW4 (aa5-186). This antibody is tested and proven to work in the following applications:

FBXW4 sgRNA CRISPR Lentivector set (Human)

K0767301 3 x 1.0 ug
EUR 339

Fbxw4 sgRNA CRISPR Lentivector set (Mouse)

K4684801 3 x 1.0 ug
EUR 339

Fbxw4 sgRNA CRISPR Lentivector set (Rat)

K6151401 3 x 1.0 ug
EUR 339

FBXW4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767302 1.0 ug DNA
EUR 154

FBXW4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767303 1.0 ug DNA
EUR 154

FBXW4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767304 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4684802 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4684803 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4684804 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6151402 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6151403 1.0 ug DNA
EUR 154

Fbxw4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6151404 1.0 ug DNA
EUR 154

FBXW4 Protein Vector (Mouse) (pPB-C-His)

PV178874 500 ng
EUR 603

FBXW4 Protein Vector (Mouse) (pPB-N-His)

PV178875 500 ng
EUR 603

FBXW4 Protein Vector (Mouse) (pPM-C-HA)

PV178876 500 ng
EUR 603

FBXW4 Protein Vector (Mouse) (pPM-C-His)

PV178877 500 ng
EUR 603

FBXW4 Protein Vector (Human) (pPB-C-His)

PV015949 500 ng
EUR 329

FBXW4 Protein Vector (Human) (pPB-N-His)

PV015950 500 ng
EUR 329

FBXW4 Protein Vector (Human) (pPM-C-HA)

PV015951 500 ng
EUR 329

FBXW4 Protein Vector (Human) (pPM-C-His)

PV015952 500 ng
EUR 329

FBXW4 Protein Vector (Rat) (pPB-C-His)

PV268106 500 ng
EUR 603

FBXW4 Protein Vector (Rat) (pPB-N-His)

PV268107 500 ng
EUR 603

FBXW4 Protein Vector (Rat) (pPM-C-HA)

PV268108 500 ng
EUR 603

FBXW4 Protein Vector (Rat) (pPM-C-His)

PV268109 500 ng
EUR 603

Fbxw4 3'UTR Luciferase Stable Cell Line

TU204531 1.0 ml Ask for price

Fbxw4 3'UTR GFP Stable Cell Line

TU156464 1.0 ml Ask for price

FBXW4 3'UTR Luciferase Stable Cell Line

TU007810 1.0 ml
EUR 1394

Fbxw4 3'UTR Luciferase Stable Cell Line

TU106464 1.0 ml Ask for price

FBXW4 3'UTR GFP Stable Cell Line

TU057810 1.0 ml
EUR 1394

Fbxw4 3'UTR GFP Stable Cell Line

TU254531 1.0 ml Ask for price

FBXW4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791629 1.0 ug DNA
EUR 316

FBXW4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791630 1.0 ug DNA
EUR 316

Human F-box/WD repeat-containing protein 4 (FBXW4)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human F-box/WD repeat-containing protein 4(FBXW4) expressed in E.coli

FBXW4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0767305 3 x 1.0 ug
EUR 376

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody

abx037921-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 4 (FBXW4) Antibody
