Gentaur SARS-CoV-2 Antigen Test Kit (Colloidal Gold)

Instruction for SARS-CoV-2 Antigen Test Kit (Colloidal Gold)

1. Product Name
Generic name: SARS-CoV-2 Antigen Test Kit (Colloidal Gold)
Trade name: SARS-CoV-2 Antigen
2. Package
Specification 1: 1T/kit REF: 52104081
Specification 2: 5T/kit REF: 52112079
Specification 3: 10T/kit REF: 52025096
Specification 4: 25T/kit REF: 52026075
Specification 5: 50T/kit REF: 52027077
3. Intended Use & Indication
Genrui SARS-CoV-2 Antigen Test Kit (Colloidal Gold) is an immunochromatographic
assay for rapid, qualitative detection of severe acute respiratory syndrome
coronavirus 2 (SARS-CoV-2) antigen from the nasopharyngeal swab or opharyngeal
swab specimen. The test is to be used as an aid in the diagnosis of coronavirus
infection disease (COVID-19), which is caused by SARS-CoV-2.
The test provides preliminary test results. Negative results cannot exclude
SARS-CoV-2 infection and they cannot be used as the sole basis for treatment or
other management decision.
For in vitro diagnostic use only. For professional use only.
4. Test Principle
This product uses highly specific antibody-antigen reaction and colloidal gold
immunochromatographic technology. The reagent contains anti- SARS-CoV-2
monoclonal antibodies pre-fixed on the test area (T) on the membrane and anti
SARS-CoV-2 monoclonal antibody gold-labeled conjugate labeled on the gold label
pad.
During the test, the processed sample to be tested is dropped into the reagent
loading place. When the sample contains SARS-CoV-2 antigen, the SARS-CoV-2
antigen in the sample is first combined with the anti- SARS-CoV-2 antibody labeled
with colloidal gold, and then the conjugate is chromatographed upward under the
capillary effect, and it will be pre-immobilized on another membrane on the
membrane. When the anti- SARS-CoV-2 monoclonal antibody binds, a purple-red
band will appear in the test area (T). If there is no SARS-CoV-2 antigen in the sample,
there will be no purple-red band in the test area (T). Regardless of whether the novel
coronavirus antigen is present in the sample, a purple-red band will appear in the
quality control area (C). The purple-red band in the quality control area (C) is the
standard for judging whether there are enough samples and whether the
chromatography process is normal, and it also serves as an internal control standard
for reagents.
5. Precaution
(1) This kit is for in vitro diagnostic use only.
(2) All specimens should be treated as capable of transmitting diseases. Use
appropriate precautions in the collection, handling, storage and disposal of patient
samples and used kit contents.
(3) Wear appropriate personal protective equipment (e.g. protective gloves, medical
mask, goggles and lab coat) when handing the contents of this kit.
(4) If the virus sampling solution is used for specimen processing, it can be directly
detected without using extraction buffer.
(5) Proper specimen collection, storage and transport are critical to the performance
of this test.
(6) Discard after first use. The sample extraction tube, the dropper and the test
device cannot be reused.
(7) Avoid high temperature during the experiment. Test cards and detection buffer
stored at low temperature must be brought to room temperature before opening to
avoid moisture absorption.
(8) Do not touch the reaction area of test strip.
(9)Do not use test kit beyond the expiration date.
(10)Do not use the kit if the pouch is punctured or not well sealed.
(11)Testing should be applied by professionally trained staff working in certified
laboratories or clinics at which the sample(s) is taken by qualified medical personnel.
(12) The test result should be interpreted by the physician along with clinical findings
and other laboratory test results.
(13) Disposal of the diagnostic kits: All specimens and the used-kit have the
infectious risk. The process of disposing the diagnostic kits must follow the local
infectious disposal law or laboratory regulation.
6. Main Components& Additional required equipment
The test kit consists of test card, sample diluent, extraction tube and the instruction.
(1) The test card consists of the card housing and test strip. Test strip contains a
sample pad, glass fiber (Colloidal gold labeled anti-SARS-CoV-2 monoclonal
antibody), nitrocellulose (NC) membrane (test area (T) is coated with
anti-SARS-CoV-2 monoclonal antibody, quality control area (C) is coated with goat
anti-mouse antibody, absorbent paper and PVC plate.
(2) Sample diluent: the main component is phosphate buffer (PBS).
7. Accessories Required But Not Provided
(1) Nasopharyngeal swab or oropharyngeal swab
(2) Viral Transport Media (VTM)
(3) Tongue depressor
(4) Extraction tube holder
(5) Timer
(6) Personal protective equipment, such a protective gloves, medical mask, goggles
and lab coat.
(7) Appropriate biohazard waste container and disinfectants.
8. Storage & Transport conditions
(1) The test kit can be stored at 2-30℃, aluminum foil bag in a sealed state is valid for
18 months , once opened, it is valid for 1 hour when the humidity is less than 65%.
Make sure to use the product immediately after opening the packing bags when
humidity is higher than 65%. The opening period of sample solution is 1 month. And
the production date is shown in the outer packing box.
(2) Transport at 2-30℃.
9. Sample Requirements
(1) Both human oropharyngeal swab and nasopharyngeal swab can be used for
testing.
(2) The sample should be used as soon as possible after collection. If it cannot be
used immediately, it must be stored at 2-8°C within 3 days. For long-term storage, it
must be stored frozen below -70°C.
(3) The samples must be returned to room temperature (18-28°C) before testing. The
frozen samples must be completely thawed, rewarmed, and mixed before use.
10. Specimen Collection And Preparation
The test can be performed with oropharyngeal swab and nasopharyngeal swab
specimen.
(1) According to standard nasopharyngeal swab or oropharyngeal swab specimen
collection procedure.
(2)nasopharyngeal swab specimen collection: Tilt patient’s head back 70 degrees.
Insert swab into nostril (Swab should reach depth equal to distance from nostrils to
outer opening of the ear). Leave swab in place for several seconds to absorb
secretions. Slowly remove swab while rotating it.
(3) Oropharyngeal swab specimen collection: Insert swab into the posterior pharyn

Genbody exporteert Covid-19, multi-diagnosekit voor influenza

GenBody Influenza / COVID-19 Ag Multi

, een snelle diagnostische testkit voor antigeen voor Covid-19 en influenza, op de wereldmarkt zou lanceren.

Genbody heeft vrijdag de exportgoedkeuring voor GenBody Influenza / COVID-Ag Multi gewonnen van het Ministerie van Voedsel- en Drugsveiligheid.

“De kit kan gelijktijdig in slechts 15 minuten controleren op Covid-19 en influenza-infectie, en is goedkoop en gemakkelijk te gebruiken in het veld zonder aanvullende medische apparatuur”,

“Onze multidiagnoseset kan snel onderscheid maken tussen de twee ziekten, die gelijkaardige ademhalingssymptomen zijn met een hoge overdrachtssnelheid.”

Het bedrijf zei dat zijn testkit de goedkeuring heeft gekregen van het Ministerie van Voedsel- en Geneesmiddelenveiligheid om de twee ziekten tegelijkertijd te testen Voor de eerste keer.

Genbody CTO Jung Jum-kyu zei: “Aangezien Covid-19 naar verwachting in de nabije toekomst zal voortduren, is een snelle reactie nodig als een bijkomende crisis, waaronder de grieppandemie, nadert.”

Genomics Overzicht

  Genetische Manipulaties AAV (Adeno Associated Virus) productlijn Geacetyleerde histondetectie Geacetyleerd histon-doelonderzoek Adenovirus-productlijn Biochemicaliën Capillaire elektroforese DNA-sequencing (Sanger-sequencing) cDNA-klonen cDNA-normalisatie cDNA-standaarden cDNA-synthese Hulpmiddelen voor celbeplating Cell Tracking door genetische NGS-streepjescode-etikettering Chromatine-analyse Circulerende histon kwantificering Kloon Screening Kits Klonen en expressievectoren Kits voor het klonen Kloondiensten Competente E. coli-cellen Competente Vibrio natriegens-cellen DNA-versterking DNA- en histon-demethylase-assays […]

BEREIDING VAN GELEVERDE REAGENTIA PLAATLEZER

VOORZORGSMAATREGELEN EN VEILIGHEID De ELISA-tests zijn tijd- en temperatuurgevoelig. Om onjuiste resultaten te voorkomen, volgt u strikt de stappen van de testprocedure en wijzigt u deze niet. Wissel geen reagentia uit verschillende partijen uit en gebruik geen reagentia uit andere in de handel verkrijgbare De componenten van de kit zijn nauwkeurig op elkaar afgestemd voor […]

MPDU1

Western Blot antibodies to the MPDU1 Gene

Rabbit Polyclonals

MPDU1 siRNA

20-abx924439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MPDU1 Antibody (HRP)

20-abx304518
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (FITC)

20-abx304519
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 Antibody (Biotin)

20-abx304520
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MPDU1 cloning plasmid

CSB-CL014744HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggcggccgaggcggacggaccgcttaaacggctgctcgtgccgattcttttacctgagaaatgctacgaccaacttttcgttcagtgggacttgcttcacgtcccctgcctcaagattctcctcagcaaaggcctggggctgggcattgtggctggctcacttctagtaaagct
  • Show more
Description: A cloning plasmid for the MPDU1 gene.

MPDU1 Polyclonal Antibody

A62970 100 µg
EUR 570.55
Description: The best epigenetics products

MPDU1 Antibody, HRP conjugated

1-CSB-PA014744LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPDU1 Antibody, FITC conjugated

1-CSB-PA014744LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPDU1 Antibody, Biotin conjugated

1-CSB-PA014744LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPDU1. Recognizes MPDU1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human MPDU1 ELISA KIT

ELI-14234h 96 Tests
EUR 824

Mouse Mpdu1 ELISA KIT

ELI-16579m 96 Tests
EUR 865

Human MPDU1 shRNA Plasmid

20-abx956331
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MPDU1 Recombinant Protein (Human)

RP019753 100 ug Ask for price

MPDU1 Recombinant Protein (Mouse)

RP151229 100 ug Ask for price

MPDU1 Recombinant Protein (Rat)

RP212120 100 ug Ask for price

MPDU1 Polyclonal Antibody, HRP Conjugated

A62971 100 µg
EUR 570.55
Description: kits suitable for this type of research

MPDU1 Polyclonal Antibody, FITC Conjugated

A62972 100 µg
EUR 570.55
Description: fast delivery possible

MPDU1 Polyclonal Antibody, Biotin Conjugated

A62973 100 µg
EUR 570.55
Description: reagents widely cited

Mpdu1 ORF Vector (Rat) (pORF)

ORF070708 1.0 ug DNA
EUR 506

MPDU1 ORF Vector (Human) (pORF)

ORF006585 1.0 ug DNA
EUR 95

Mpdu1 ORF Vector (Mouse) (pORF)

ORF050411 1.0 ug DNA
EUR 506

Mpdu1 sgRNA CRISPR Lentivector set (Rat)

K6170601 3 x 1.0 ug
EUR 339

MPDU1 sgRNA CRISPR Lentivector set (Human)

K1319501 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector set (Mouse)

K4472301 3 x 1.0 ug
EUR 339

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6170602 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6170603 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6170604 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1319502 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1319503 1.0 ug DNA
EUR 154

MPDU1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1319504 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4472302 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4472303 1.0 ug DNA
EUR 154

Mpdu1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4472304 1.0 ug DNA
EUR 154

MPDU1 Protein Vector (Mouse) (pPB-C-His)

PV201642 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPB-N-His)

PV201643 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-HA)

PV201644 500 ng
EUR 603

MPDU1 Protein Vector (Mouse) (pPM-C-His)

PV201645 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-C-His)

PV282830 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPB-N-His)

PV282831 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-HA)

PV282832 500 ng
EUR 603

MPDU1 Protein Vector (Rat) (pPM-C-His)

PV282833 500 ng
EUR 603

MPDU1 Protein Vector (Human) (pPB-C-His)

PV026337 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPB-N-His)

PV026338 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-HA)

PV026339 500 ng
EUR 329

MPDU1 Protein Vector (Human) (pPM-C-His)

PV026340 500 ng
EUR 329

Mpdu1 3'UTR Luciferase Stable Cell Line

TU113346 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU163346 1.0 ml Ask for price

Mpdu1 3'UTR Luciferase Stable Cell Line

TU213328 1.0 ml Ask for price

Mpdu1 3'UTR GFP Stable Cell Line

TU263328 1.0 ml Ask for price

MPDU1 3'UTR GFP Stable Cell Line

TU064467 1.0 ml
EUR 1394

MPDU1 3'UTR Luciferase Stable Cell Line

TU014467 1.0 ml
EUR 1394

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

abx031453-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mannose-P-Dolichol Utilization Defect 1 Protein (MPDU1) Antibody

20-abx301940
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6170605 3 x 1.0 ug
EUR 376

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1319505 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4472305 3 x 1.0 ug
EUR 376

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6170606 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6170607 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6170608 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1319506 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1319507 1.0 ug DNA
EUR 167

MPDU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1319508 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4472306 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4472307 1.0 ug DNA
EUR 167

Mpdu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4472308 1.0 ug DNA
EUR 167

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-48T 48T
EUR 332
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE70984-96T 96T
EUR 539
  • Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors.
Description: Quantitative sandwich ELISA for measuring Mouse Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-48T 48T
EUR 332
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mannose-P-dolichol utilization defect 1 protein (MPDU1)

KTE61570-96T 96T
EUR 539
  • MPDU1 encodes an endoplasmic reticulum membrane protein that is required for utilization of the mannose donor mannose-P-dolichol in the synthesis of lipid-linked oligosaccharides and glycosylphosphatidylinositols. Mutations in MPDU1 result in congeni
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mannose-P-dolichol utilization defect 1 protein (MPDU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

LSAMP

LSAMP siRNA

20-abx903064
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LSAMP siRNA

20-abx923038
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LSAMP siRNA

20-abx923039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LSAMP antibody

70R-6118 50 ug
EUR 467
Description: Rabbit polyclonal LSAMP antibody raised against the N terminal of LSAMP

LSAMP Antibody

42962-100ul 100ul
EUR 252

LSAMP antibody

70R-18316 50 ul
EUR 435
Description: Rabbit polyclonal LSAMP antibody

LSAMP Antibody

1-CSB-PA013197GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LSAMP Antibody

1-CSB-PA013197LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

anti-LSAMP

YF-PA12985 50 ug
EUR 363
Description: Mouse polyclonal to LSAMP

LSAMP Conjugated Antibody

C42962 100ul
EUR 397

LSAMP cloning plasmid

CSB-CL013197HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atggtcaggagagttcagccggatcggaaacagttgccactggtcctactgagattgctctgccttcttcccacaggactgcctgttcgcagcgtggattttaaccgaggcacggacaacatcaccgtgaggcagggggacacagccatcctcaggtgcgttgtagaagacaaga
  • Show more
Description: A cloning plasmid for the LSAMP gene.

anti- LSAMP antibody

FNab04868 100µg
EUR 548.75
  • Immunogen: limbic system-associated membrane protein
  • Uniprot ID: Q13449
  • Gene ID: 4045
  • Research Area: Neuroscience, Immunology, Developmental biology
Description: Antibody raised against LSAMP

LSAMP Rabbit pAb

A14248-100ul 100 ul
EUR 308

LSAMP Rabbit pAb

A14248-200ul 200 ul
EUR 459

LSAMP Rabbit pAb

A14248-20ul 20 ul
EUR 183

LSAMP Rabbit pAb

A14248-50ul 50 ul
EUR 223

LSAMP Polyclonal Antibody

A69583 100 ?g
EUR 628.55
Description: kits suitable for this type of research

LSAMP Blocking Peptide

33R-6605 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LSAMP antibody, catalog no. 70R-6118

Anti-LSAMP antibody

PAab04868 100 ug
EUR 386

Anti-LSAMP antibody

STJ116461 100 µl
EUR 277
Description: This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.

Mouse LSAMP shRNA Plasmid

20-abx982992
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat LSAMP shRNA Plasmid

20-abx985586
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LSAMP ELISA KIT|Human

EF010736 96 Tests
EUR 689

Human LSAMP ELISA KIT

ELI-45828h 96 Tests
EUR 824

Mouse Lsamp ELISA KIT

ELI-42189m 96 Tests
EUR 865

Human LSAMP shRNA Plasmid

20-abx952734
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LSAMP Antibody, HRP conjugated

1-CSB-PA013197LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LSAMP Antibody, FITC conjugated

1-CSB-PA013197LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LSAMP Antibody, Biotin conjugated

1-CSB-PA013197LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSAMP. Recognizes LSAMP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LSAMP Recombinant Protein (Human)

RP018346 100 ug Ask for price

LSAMP Recombinant Protein (Rat)

RP210176 100 ug Ask for price

LSAMP Recombinant Protein (Mouse)

RP148469 100 ug Ask for price

LSAMP Polyclonal Antibody, HRP Conjugated

A69584 100 ?g
EUR 628.55
Description: fast delivery possible

LSAMP Polyclonal Antibody, FITC Conjugated

A69585 100 ?g
EUR 628.55
Description: reagents widely cited

LSAMP Polyclonal Antibody, Biotin Conjugated

A69586 100 ?g
EUR 628.55
Description: Ask the seller for details

LSAMP ORF Vector (Human) (pORF)

ORF006116 1.0 ug DNA
EUR 95

Lsamp ORF Vector (Mouse) (pORF)

ORF049491 1.0 ug DNA
EUR 506

Lsamp ORF Vector (Rat) (pORF)

ORF070060 1.0 ug DNA
EUR 506

LSAMP sgRNA CRISPR Lentivector set (Human)

K1240501 3 x 1.0 ug
EUR 339

Lsamp sgRNA CRISPR Lentivector set (Mouse)

K4930701 3 x 1.0 ug
EUR 339

Lsamp sgRNA CRISPR Lentivector set (Rat)

K6814801 3 x 1.0 ug
EUR 339

LSAMP-AS1 ORF Vector (Human) (pORF)

ORF023154 1.0 ug DNA Ask for price

LSAMP-AS2 ORF Vector (Human) (pORF)

ORF023155 1.0 ug DNA Ask for price

LSAMP-AS3 ORF Vector (Human) (pORF)

ORF023156 1.0 ug DNA Ask for price

LSAMP-AS4 ORF Vector (Human) (pORF)

ORF023157 1.0 ug DNA Ask for price

Limbic System-Associated Membrane Protein (LSAMP) Antibody

20-abx113512
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody

abx146203-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody

20-abx338649
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody

abx234868-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

LSAMP sgRNA CRISPR Lentivector (Human) (Target 1)

K1240502 1.0 ug DNA
EUR 154

LSAMP sgRNA CRISPR Lentivector (Human) (Target 2)

K1240503 1.0 ug DNA
EUR 154

LSAMP sgRNA CRISPR Lentivector (Human) (Target 3)

K1240504 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4930702 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4930703 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4930704 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Rat) (Target 1)

K6814802 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Rat) (Target 2)

K6814803 1.0 ug DNA
EUR 154

Lsamp sgRNA CRISPR Lentivector (Rat) (Target 3)

K6814804 1.0 ug DNA
EUR 154

LSAMP Protein Vector (Human) (pPB-C-His)

PV024461 500 ng
EUR 329

LSAMP Protein Vector (Human) (pPB-N-His)

PV024462 500 ng
EUR 329

LSAMP Protein Vector (Human) (pPM-C-HA)

PV024463 500 ng
EUR 329

LSAMP Protein Vector (Human) (pPM-C-His)

PV024464 500 ng
EUR 329

LSAMP Protein Vector (Rat) (pPB-C-His)

PV280238 500 ng
EUR 603

LSAMP Protein Vector (Rat) (pPB-N-His)

PV280239 500 ng
EUR 603

LSAMP Protein Vector (Rat) (pPM-C-HA)

PV280240 500 ng
EUR 603

LSAMP Protein Vector (Rat) (pPM-C-His)

PV280241 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPB-C-His)

PV197962 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPB-N-His)

PV197963 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPM-C-HA)

PV197964 500 ng
EUR 603

LSAMP Protein Vector (Mouse) (pPM-C-His)

PV197965 500 ng
EUR 603

Lsamp 3'UTR GFP Stable Cell Line

TU162670 1.0 ml Ask for price

Lsamp 3'UTR Luciferase Stable Cell Line

TU212627 1.0 ml Ask for price

LSAMP 3'UTR Luciferase Stable Cell Line

TU012722 1.0 ml
EUR 1394

Lsamp 3'UTR Luciferase Stable Cell Line

TU112670 1.0 ml Ask for price

LSAMP 3'UTR GFP Stable Cell Line

TU062722 1.0 ml
EUR 1394

Lsamp 3'UTR GFP Stable Cell Line

TU262627 1.0 ml Ask for price

Limbic System-Associated Membrane Protein (LSAMP) Antibody (HRP)

20-abx336381
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody (FITC)

20-abx336382
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Limbic System-Associated Membrane Protein (LSAMP) Antibody (Biotin)

20-abx336383
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LSAMP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV684901 1.0 ug DNA
EUR 682

LSAMP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV684905 1.0 ug DNA
EUR 682

LSAMP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV684906 1.0 ug DNA
EUR 682

Lsamp ELISA Kit| Rat Limbic system-associated membrane protein

EF018912 96 Tests
EUR 689

Lsamp ELISA Kit| Mouse Limbic system-associated membrane protei

EF015391 96 Tests
EUR 689

Human Limbic System-Associated Membrane Protein (LSAMP) ELISA Kit

abx388329-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Limbic System-Associated Membrane Protein (LSAMP) ELISA Kit

abx389756-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Limbic System-Associated Membrane Protein (LSAMP) ELISA Kit

abx391554-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

LSAMP-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV732287 1.0 ug DNA Ask for price

LSAMP-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV732291 1.0 ug DNA Ask for price

LSAMP-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV732292 1.0 ug DNA Ask for price

LSAMP-AS2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV732293 1.0 ug DNA Ask for price

LSAMP-AS2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV732297 1.0 ug DNA Ask for price

LSAMP-AS2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV732298 1.0 ug DNA Ask for price

LSAMP-AS4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV732299 1.0 ug DNA Ask for price

LSAMP-AS4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV732303 1.0 ug DNA Ask for price

LYPD8

LYPD8 siRNA

20-abx923187
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Mouse LYPD8 shRNA Plasmid

20-abx977141
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LYPD8 shRNA Plasmid

20-abx968530
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KIF5B

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Hu-96T 96T
EUR 673
  • Should the Human Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Mu-48T 48T
EUR 527
  • Should the Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Mu-96T 96T
EUR 688
  • Should the Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Ra-48T 48T
EUR 549
  • Should the Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

DLR-KIF5B-Ra-96T 96T
EUR 718
  • Should the Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Kinesin Family, Member 5B (KIF5B) in samples from tissue homogenates or other biological fluids.

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Hu-48Tests 48 Tests
EUR 544

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Hu-96Tests 96 Tests
EUR 756

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Mu-48Tests 48 Tests
EUR 557

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Mu-96Tests 96 Tests
EUR 774

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Ra-48Tests 48 Tests
EUR 583

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RDR-KIF5B-Ra-96Tests 96 Tests
EUR 811

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Hu-48Tests 48 Tests
EUR 521

Human Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Hu-96Tests 96 Tests
EUR 723

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Mu-48Tests 48 Tests
EUR 533

Mouse Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Mu-96Tests 96 Tests
EUR 740

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Ra-48Tests 48 Tests
EUR 557

Rat Kinesin Family, Member 5B (KIF5B) ELISA Kit

RD-KIF5B-Ra-96Tests 96 Tests
EUR 775

Kif5b/ Rat Kif5b ELISA Kit

ELI-37195r 96 Tests
EUR 886

KIF5B antibody

70R-5541 50 ug
EUR 467
Description: Rabbit polyclonal KIF5B antibody raised against the C terminal of KIF5B

KIF5B antibody

70R-5599 50 ug
EUR 467
Description: Rabbit polyclonal KIF5B antibody raised against the N terminal of KIF5B

KIF5B Antibody

1-CSB-PA012342LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

KIF5B siRNA

20-abx902849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF5B siRNA

20-abx921641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF5B siRNA

20-abx921642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF5B Antibody

AF7947 200ul
EUR 376
Description: KIF5B Antibody detects endogenous levels of KIF5B.

KIF5B Polyclonal Antibody

28899-100ul 100ul
EUR 252

KIF5B Polyclonal Antibody

28899-50ul 50ul
EUR 187

KIF5B Rabbit pAb

A15284-100ul 100 ul
EUR 308

KIF5B Rabbit pAb

A15284-200ul 200 ul
EUR 459

KIF5B Rabbit pAb

A15284-20ul 20 ul
EUR 183

KIF5B Rabbit pAb

A15284-50ul 50 ul
EUR 223

KIF5B Blocking Peptide

33R-1396 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF5B antibody, catalog no. 70R-5541

KIF5B Blocking Peptide

33R-1753 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF5B antibody, catalog no. 70R-5599

KIF5B Blocking Peptide

AF7947-BP 1mg
EUR 195

KIF5B cloning plasmid

CSB-CL012342HU-10ug 10ug
EUR 919
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2892
  • Sequence: atggcggacctggccgagtgcaacatcaaagtgatgtgtcgcttcagacctctcaacgagtctgaagtgaaccgcggcgacaagtacatcgccaagtttcagggagaagacacggtcgtgatcgcgtccaagccttatgcatttgatcgggtgttccagtcaagcacatctcaag
  • Show more
Description: A cloning plasmid for the KIF5B gene.

anti- KIF5B antibody

FNab04567 100µg
EUR 505.25
  • Immunogen: kinesin family member 5B
  • Uniprot ID: P33176
  • Gene ID: 3799
  • Research Area: Neuroscience
Description: Antibody raised against KIF5B

Anti-KIF5B antibody

PAab04567 100 ug
EUR 355

pCR4-TOPO-KIF5B

PVT14703 2 ug
EUR 495

Anti-KIF5B antibody

STJ117479 100 µl
EUR 277

KIF5B (Phospho-Ser154) Antibody

13288-100ul 100ul
EUR 252

KIF5B (Phospho-Ser154) Antibody

13288-50ul 50ul
EUR 187

KIF5B ELISA KIT|Human

EF010524 96 Tests
EUR 689

Phospho-KIF5B (Ser154) Antibody

AF7447 200ul
EUR 376
Description: Phospho-KIF5B (Ser154) Antibody detects endogenous levels of KIF5B only when phosphorylated at Ser154.

Rat KIF5B shRNA Plasmid

20-abx987473
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KIF5B Polyclonal Conjugated Antibody

C28899 100ul
EUR 397

KIF5B Antibody, HRP conjugated

1-CSB-PA012342LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KIF5B Antibody, FITC conjugated

1-CSB-PA012342LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KIF5B Antibody, Biotin conjugated

1-CSB-PA012342LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KIF5B. Recognizes KIF5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human KIF5B shRNA Plasmid

20-abx952570
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse KIF5B shRNA Plasmid

20-abx971190
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-KIF5B (Ser154) Blocking Peptide

AF7447-BP 1mg
EUR 195

KIF5B (Phospho-Ser154) Conjugated Antibody

C13288 100ul
EUR 397

Kif5b ORF Vector (Rat) (pORF)

ORF069059 1.0 ug DNA
EUR 506

KIF5B ORF Vector (Human) (pORF)

ORF013470 1.0 ug DNA
EUR 354

Kif5b ORF Vector (Mouse) (pORF)

ORF048585 1.0 ug DNA
EUR 506

KIF5B ELISA Kit (Rat) (OKCD08800)

OKCD08800 96 Wells
EUR 1053
Description: Description of target: mouse homolog is the heavy chain of kinesin; essential for mitochondrial and lysosomal dispersion.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

KIF5B ELISA Kit (Rat) (OKDD00860)

OKDD00860 96 Wells
EUR 1040
Description: Description of target: Mouse homolog is the heavy chain of kinesin, essential for mitochondrial and lysosomal dispersion [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.059ng/mL

Kinesin Family, Member 5B (KIF5B) Antibody

20-abx130104
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kinesin Family, Member 5B (KIF5B) Antibody

20-abx173265
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kinesin Family, Member 5B (KIF5B) Antibody

20-abx338851
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinesin-1 Heavy Chain (KIF5B) Antibody

abx234567-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Kif5b sgRNA CRISPR Lentivector set (Rat)

K6962801 3 x 1.0 ug
EUR 339

Kif5b sgRNA CRISPR Lentivector set (Mouse)

K3841701 3 x 1.0 ug
EUR 339

KIF5B sgRNA CRISPR Lentivector set (Human)

K1146801 3 x 1.0 ug
EUR 339

Recombinant Kinesin Family, Member 5B (KIF5B)

4-RPF507Ra01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q2PQA9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Kinesin Family, Member 5B expressed in: E.coli

Rat Kinesin Family, Member 5B (KIF5B) Protein

20-abx167614
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kinesin Family, Member 5B (KIF5B) Antibody (HRP)

20-abx336249
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinesin Family, Member 5B (KIF5B) Antibody (FITC)

20-abx336250
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinesin Family, Member 5B (KIF5B) Antibody (Biotin)

20-abx336251
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kif5b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6962802 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6962803 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6962804 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3841702 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3841703 1.0 ug DNA
EUR 154

Kif5b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3841704 1.0 ug DNA
EUR 154

KIF5B sgRNA CRISPR Lentivector (Human) (Target 1)

K1146802 1.0 ug DNA
EUR 154

KIF5B sgRNA CRISPR Lentivector (Human) (Target 2)

K1146803 1.0 ug DNA
EUR 154

KIF5B sgRNA CRISPR Lentivector (Human) (Target 3)

K1146804 1.0 ug DNA
EUR 154

KIF5B Protein Vector (Rat) (pPB-C-His)

PV276234 500 ng
EUR 1166

KIF5B Protein Vector (Rat) (pPB-N-His)

PV276235 500 ng
EUR 1166

KIF5B Protein Vector (Rat) (pPM-C-HA)

PV276236 500 ng
EUR 1166

KIF5B Protein Vector (Rat) (pPM-C-His)

PV276237 500 ng
EUR 1166

KIF5B Protein Vector (Mouse) (pPB-C-His)

PV194338 500 ng
EUR 1065

KIF5B Protein Vector (Mouse) (pPB-N-His)

PV194339 500 ng
EUR 1065

KIF5B Protein Vector (Mouse) (pPM-C-HA)

PV194340 500 ng
EUR 1065

KIF5B Protein Vector (Mouse) (pPM-C-His)

PV194341 500 ng
EUR 1065

KIF5B Protein Vector (Human) (pPB-C-His)

PV053877 500 ng
EUR 481

KIF5B Protein Vector (Human) (pPB-N-His)

PV053878 500 ng
EUR 481

KIF5B Protein Vector (Human) (pPM-C-HA)

PV053879 500 ng
EUR 481

KIF5B Protein Vector (Human) (pPM-C-His)

PV053880 500 ng
EUR 481

Kif5b 3'UTR Luciferase Stable Cell Line

TU110573 1.0 ml Ask for price

Kif5b 3'UTR GFP Stable Cell Line

TU160573 1.0 ml Ask for price

Kif5b 3'UTR Luciferase Stable Cell Line

TU206706 1.0 ml Ask for price

Kif5b 3'UTR GFP Stable Cell Line

TU256706 1.0 ml Ask for price

KIF5B 3'UTR GFP Stable Cell Line

TU061761 1.0 ml
EUR 1521

HDGF

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Hu-96T 96T
EUR 548
  • Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Mu-48T 48T
EUR 435
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

DLR-HDGF-Mu-96T 96T
EUR 561
  • Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Hu-48Tests 48 Tests
EUR 418

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Hu-96Tests 96 Tests
EUR 575

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Mu-48Tests 48 Tests
EUR 429

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RD-HDGF-Mu-96Tests 96 Tests
EUR 591

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Hu-48Tests 48 Tests
EUR 436

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Hu-96Tests 96 Tests
EUR 601

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Mu-48Tests 48 Tests
EUR 447

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit

RDR-HDGF-Mu-96Tests 96 Tests
EUR 618

Hdgf/ Rat Hdgf ELISA Kit

ELI-38905r 96 Tests
EUR 886

HDGF siRNA

20-abx902439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF siRNA

20-abx919203
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF siRNA

20-abx919204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HDGF Antibody

ABD7289 100 ug
EUR 438

HDGF protein

30R-1402 100 ug
EUR 397
Description: Purified recombinant Human HDGF protein

HDGF Antibody

32788-100ul 100ul
EUR 252

HDGF antibody

10R-1523 100 ug
EUR 512
Description: Mouse monoclonal HDGF antibody

HDGF antibody

70R-17711 50 ul
EUR 435
Description: Rabbit polyclonal HDGF antibody

HDGF Antibody

DF7289 200ul
EUR 304
Description: HDGF Antibody detects endogenous levels of total HDGF.

HDGF Antibody

1-CSB-PA01004A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA

HDGF Antibody

1-CSB-PA010249GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pOTB7-HDGF

PVT14602 2 ug
EUR 495

anti-HDGF

YF-PA12275 50 ug
EUR 363
Description: Mouse polyclonal to HDGF

anti-HDGF

YF-PA23871 50 ul
EUR 334
Description: Mouse polyclonal to HDGF

Polyclonal HDGF Antibody

APR03208G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF . This antibody is tested and proven to work in the following applications:

HDGF Conjugated Antibody

C32788 100ul
EUR 397

HDGF cloning plasmid

CSB-CL010249HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: atgtcgcgatccaaccggcagaaggagtacaaatgcggggacctggtgttcgccaagatgaagggctacccacactggccggcccggattgacgagatgcctgaggctgccgtgaaatcaacagccaacaaataccaagtcttttttttcgggacccacgagacggcattcctggg
  • Show more
Description: A cloning plasmid for the HDGF gene.

anti- HDGF antibody

FNab03808 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: hepatoma-derived growth factor (high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 3068
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

anti- HDGF antibody

FNab03809 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • IF: 1:10-1:100
  • IHC: 1:50-1:500
  • Immunogen: hepatoma-derived growth factor(high-mobility group protein 1-like)
  • Uniprot ID: P51858
  • Gene ID: 81932
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

HDGF Polyclonal Antibody

ES8731-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA

HDGF Polyclonal Antibody

ES8731-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HDGF from Human. This antibody is tested and validated for IHC, WB, ELISA

HDGF Polyclonal Antibody

ABP58763-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody

ABP58763-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody

ABP58763-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

Anti-HDGF Antibody

A01057 100ug/vial
EUR 334

HDGF Polyclonal Antibody

A53048 100 µg
EUR 570.55
Description: Ask the seller for details

HDGF Rabbit pAb

A5347-100ul 100 ul
EUR 308

HDGF Rabbit pAb

A5347-200ul 200 ul
EUR 459

HDGF Rabbit pAb

A5347-20ul 20 ul
EUR 183

HDGF Rabbit pAb

A5347-50ul 50 ul
EUR 223

HDGF Rabbit pAb

A13654-100ul 100 ul
EUR 308

HDGF Rabbit pAb

A13654-200ul 200 ul
EUR 459

HDGF Rabbit pAb

A13654-20ul 20 ul
EUR 183

HDGF Rabbit pAb

A13654-50ul 50 ul
EUR 223

HDGF Polyclonal Antibody

46852-100ul 100ul
EUR 252

HDGF Polyclonal Antibody

46852-50ul 50ul
EUR 187

HDGF Blocking Peptide

DF7289-BP 1mg
EUR 195

Anti-HDGF antibody

PAab03808 100 ug
EUR 412

pOTB7-HDGF Plasmid

PVTB00247S 2 ug
EUR 356

Anti-HDGF antibody

STJ98794 200 µl
EUR 197
Description: Rabbit polyclonal to HDGF.

Anti-HDGF antibody

STJ27300 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-HDGF antibody

STJ115610 100 µl
EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-HDGF (2D6)

YF-MA13429 100 ug
EUR 363
Description: Mouse monoclonal to HDGF

Rat HDGF shRNA Plasmid

20-abx987193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HDGF ELISA Kit

EHH0054 96Tests
EUR 521

Goat HDGF ELISA Kit

EGTH0054 96Tests
EUR 521

Bovine HDGF ELISA Kit

EBH0054 96Tests
EUR 521

Anserini HDGF ELISA Kit

EAH0054 96Tests
EUR 521

RGS9

RGS9 siRNA

20-abx931429
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS9 siRNA

20-abx931430
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS9 antibody

70R-5843 50 ug
EUR 467
Description: Rabbit polyclonal RGS9 antibody raised against the middle region of RGS9

RGS9 Antibody

ABD7979 100 ug
EUR 438

RGS9 Antibody

45191-100ul 100ul
EUR 252

RGS9 Antibody

45191-50ul 50ul
EUR 187

RGS9 antibody

70R-19880 50 ul
EUR 435
Description: Rabbit polyclonal RGS9 antibody

RGS9 antibody

70R-1649 100 ug
EUR 377
Description: Rabbit polyclonal RGS9 antibody raised against the N terminal of RGS9

RGS9 Antibody

DF7979 200ul
EUR 304
Description: RGS9 Antibody d