ASXL2

ASXL2 siRNA

20-abx908398
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASXL2 antibody

70R-3526 50 ug
EUR 467
Description: Rabbit polyclonal ASXL2 antibody

ASXL2 Antibody

46316-100ul 100ul
EUR 252

anti-ASXL2

YF-PA19647 50 ug
EUR 363
Description: Mouse polyclonal to ASXL2

anti-ASXL2

YF-PA19648 100 ul
EUR 403
Description: Rabbit polyclonal to ASXL2

Putative Polycomb Group Protein ASXL2 (ASXL2) Antibody

abx036875-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ASXL2 Conjugated Antibody

C46316 100ul
EUR 397

ASXL2 Blocking Peptide

33R-2337 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASXL2 antibody, catalog no. 70R-3526

ASXL2 cloning plasmid

CSB-CL765736HU-10ug 10ug
EUR 881
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2757
  • Sequence: atgaaaagaactaaatgtgctgacattgacgttgagacaccggactccattctggttaatacaaatctgcgagcactgatcaacaagcacacattttcagtccttcctggagattgccagcaacgactgcttttactactcccagaggtagatcgacaggttggtccagatggtt
  • Show more
Description: A cloning plasmid for the ASXL2 gene.

Human Putative Polycomb group protein ASXL2, ASXL2 ELISA KIT

ELI-34124h 96 Tests
EUR 824

Mouse Putative Polycomb group protein ASXL2, Asxl2 ELISA KIT

ELI-34125m 96 Tests
EUR 865

Chicken Putative Polycomb group protein ASXL2, ASXL2 ELISA KIT

ELI-48977c 96 Tests
EUR 928

Mouse ASXL2 shRNA Plasmid

20-abx978374
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ASXL2 shRNA Plasmid

20-abx960596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASXL2 ORF Vector (Human) (pORF)

ORF000714 1.0 ug DNA
EUR 95

Asxl2 ORF Vector (Mouse) (pORF)

ORF039219 1.0 ug DNA
EUR 1572

ASXL2 sgRNA CRISPR Lentivector set (Human)

K0138701 3 x 1.0 ug
EUR 339

Asxl2 sgRNA CRISPR Lentivector set (Mouse)

K4946101 3 x 1.0 ug
EUR 339

ASXL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0138702 1.0 ug DNA
EUR 154

ASXL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0138703 1.0 ug DNA
EUR 154

ASXL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0138704 1.0 ug DNA
EUR 154

Asxl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4946102 1.0 ug DNA
EUR 154

Asxl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4946103 1.0 ug DNA
EUR 154

Asxl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4946104 1.0 ug DNA
EUR 154

ASXL2 Protein Vector (Human) (pPB-C-His)

PV002853 500 ng
EUR 329

ASXL2 Protein Vector (Human) (pPB-N-His)

PV002854 500 ng
EUR 329

ASXL2 Protein Vector (Human) (pPM-C-HA)

PV002855 500 ng
EUR 329

ASXL2 Protein Vector (Human) (pPM-C-His)

PV002856 500 ng
EUR 329

ASXL2 Protein Vector (Human) (pPB-His-MBP)

PV324574 500 ng
EUR 329

ASXL2 Protein Vector (Human) (pPB-His-GST)

PV324575 500 ng
EUR 329

ASXL2 Protein Vector (Mouse) (pPB-C-His)

PV156874 500 ng
EUR 2340

ASXL2 Protein Vector (Mouse) (pPB-N-His)

PV156875 500 ng
EUR 2340

ASXL2 Protein Vector (Mouse) (pPM-C-HA)

PV156876 500 ng
EUR 2340

ASXL2 Protein Vector (Mouse) (pPM-C-His)

PV156877 500 ng
EUR 2340

Asxl2 3'UTR GFP Stable Cell Line

TU152240 1.0 ml Ask for price

ASXL2 3'UTR Luciferase Stable Cell Line

TU001305 1.0 ml
EUR 4617

Asxl2 3'UTR Luciferase Stable Cell Line

TU102240 1.0 ml Ask for price

ASXL2 3'UTR GFP Stable Cell Line

TU051305 1.0 ml
EUR 4617

ASXL2 Protein Vector (Human) (pPM-N-D-C-HA)

PV324576 500 ng
EUR 329

ASXL2 Protein Vector (Human) (pPM-N-D-C-His)

PV324577 500 ng
EUR 329

ASXL2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0138705 3 x 1.0 ug
EUR 376

Asxl2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4946105 3 x 1.0 ug
EUR 376

ASXL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0138706 1.0 ug DNA
EUR 167

ASXL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0138707 1.0 ug DNA
EUR 167

ASXL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0138708 1.0 ug DNA
EUR 167

Asxl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4946106 1.0 ug DNA
EUR 167

Asxl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4946107 1.0 ug DNA
EUR 167

Asxl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4946108 1.0 ug DNA
EUR 167