ASGR1

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit

DLR-ASGR1-Hu-96T 96T
EUR 647
  • Should the Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 1 (ASGR1) in samples from tissue homogenates or other biological fluids.

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit

RDR-ASGR1-Hu-48Tests 48 Tests
EUR 522

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit

RDR-ASGR1-Hu-96Tests 96 Tests
EUR 724

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit

RD-ASGR1-Hu-48Tests 48 Tests
EUR 500

Human Asialoglycoprotein Receptor 1 (ASGR1) ELISA Kit

RD-ASGR1-Hu-96Tests 96 Tests
EUR 692

ASGR1 antibody

70R-1076 100 ug
EUR 377
Description: Rabbit polyclonal ASGR1 antibody raised against the N terminal of ASGR1

ASGR1 antibody

70R-2850 50 ug
EUR 467
Description: Rabbit polyclonal ASGR1 antibody raised against the N terminal of ASGR1

ASGR1 antibody

70R-15865 50 ul
EUR 435
Description: Rabbit polyclonal ASGR1 antibody

ASGR1 Antibody

36245-100ul 100ul
EUR 252

ASGR1 Antibody

1-CSB-PA002207GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ASGR1. Recognizes ASGR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ASGR1 Antibody

1-CSB-PA17469A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASGR1. Recognizes ASGR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ASGR1 Antibody

1-CSB-PA186229
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASGR1. Recognizes ASGR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

ASGR1 siRNA

20-abx900474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASGR1 siRNA

20-abx908330
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASGR1 siRNA

20-abx908331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASGR1 Rabbit pAb

A13279-100ul 100 ul
EUR 308

ASGR1 Rabbit pAb

A13279-200ul 200 ul
EUR 459

ASGR1 Rabbit pAb

A13279-20ul 20 ul
EUR 183

ASGR1 Rabbit pAb

A13279-50ul 50 ul
EUR 223

ASGR1 Blocking Peptide

33R-8004 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR1 antibody, catalog no. 70R-1076

ASGR1 Conjugated Antibody

C36245 100ul
EUR 397

ASGR1 cloning plasmid

CSB-CL002207HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 876
  • Sequence: atgaccaaggagtatcaagaccttcagcatctggacaatgaggagagtgaccaccatcagctcagaaaagggccacctcctccccagcccctcctgcagcgtctctgctccggacctcgcctcctcctgctctccctgggcctcagcctcctgctgcttgtggttgtctgtgtgat
  • Show more
Description: A cloning plasmid for the ASGR1 gene.

ASGR1 Rabbit pAb

A6871-100ul 100 ul
EUR 308

ASGR1 Rabbit pAb

A6871-200ul 200 ul
EUR 459

ASGR1 Rabbit pAb

A6871-20ul 20 ul
EUR 183

ASGR1 Rabbit pAb

A6871-50ul 50 ul
EUR 223

ASGR1 Polyclonal Antibody

A52388 100 µg
EUR 570.55
Description: fast delivery possible

ASGR1 Rabbit pAb

A16766-100ul 100 ul
EUR 308

ASGR1 Rabbit pAb

A16766-200ul 200 ul
EUR 459

ASGR1 Rabbit pAb

A16766-20ul 20 ul
EUR 183

ASGR1 Rabbit pAb

A16766-50ul 50 ul
EUR 223

anti- ASGR1 antibody

FNab00635 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000 - 1:4000
  • IHC: 1:50 - 1:200
  • Immunogen: asialoglycoprotein receptor 1
  • Uniprot ID: P07306
  • Gene ID: 432
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against ASGR1

Anti-ASGR1 antibody

PAab00635 100 ug
EUR 355

Anti-ASGR1 antibody

STJ28951 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ASGR1 antibody

STJ115244 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ASGR1 antibody

STJ119182 100 µl
EUR 277

ASGR1 Antibody, HRP conjugated

1-CSB-PA17469B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASGR1. Recognizes ASGR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASGR1 Antibody, FITC conjugated

1-CSB-PA17469C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASGR1. Recognizes ASGR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASGR1 Antibody, Biotin conjugated

1-CSB-PA17469D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASGR1. Recognizes ASGR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human ASGR1 ELISA Kit

EHA0614 96Tests
EUR 521

Human ASGR1 ELISA Kit

ELA-E1196h 96 Tests
EUR 824

Goat ASGR1 ELISA Kit

EGTA0614 96Tests
EUR 521

Canine ASGR1 ELISA Kit

ECA0614 96Tests
EUR 521

Chicken ASGR1 ELISA Kit

ECKA0614 96Tests
EUR 521

Anserini ASGR1 ELISA Kit

EAA0614 96Tests
EUR 521

Bovine ASGR1 ELISA Kit

EBA0614 96Tests
EUR 521

ASGR1 ELISA KIT|Human

EF004286 96 Tests
EUR 689

Rat ASGR1 shRNA Plasmid

20-abx984380
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ASGR1 shRNA Plasmid

20-abx969248
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ASGR1 shRNA Plasmid

20-abx950311
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.